Transcript: Human NM_002254.8

Homo sapiens kinesin family member 3C (KIF3C), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
KIF3C (3797)
Length:
5342
CDS:
581..2962

Additional Resources:

NCBI RefSeq record:
NM_002254.8
NBCI Gene record:
KIF3C (3797)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002254.8, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353159 GAAAGACCTTCCACGTCTAAA pLKO_005 2828 CDS 100% 13.200 18.480 N KIF3C n/a
2 TRCN0000116731 GCATGATGAGTATATCCGCGT pLKO.1 2395 CDS 100% 0.540 0.756 N KIF3C n/a
3 TRCN0000344953 GACCAGCATGATGAGTATATC pLKO_005 2390 CDS 100% 13.200 10.560 N KIF3C n/a
4 TRCN0000116727 CGAGTGAATTAGGATTTCAAA pLKO.1 4235 3UTR 100% 5.625 3.938 N KIF3C n/a
5 TRCN0000116729 CTCATGCGATTGGACAGCTTT pLKO.1 2804 CDS 100% 4.950 3.465 N KIF3C n/a
6 TRCN0000116728 GCAGAAGATGTTGGAACTGAA pLKO.1 2185 CDS 100% 4.950 3.465 N KIF3C n/a
7 TRCN0000333748 GCAGAAGATGTTGGAACTGAA pLKO_005 2185 CDS 100% 4.950 3.465 N KIF3C n/a
8 TRCN0000116730 GTACCTAATCATCGAGAACTT pLKO.1 2470 CDS 100% 0.000 0.000 N KIF3C n/a
9 TRCN0000333749 GTACCTAATCATCGAGAACTT pLKO_005 2470 CDS 100% 0.000 0.000 N KIF3C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002254.8, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000478040 CTAGGGCAGCGCGCTAGCTTAGAC pLX_317 19.5% 99.9% 100% V5 147C>T n/a
2 ccsbBroadEn_10435 pDONR223 100% 99.8% 99.7% None 147C>T;2376_2377delTGinsNN n/a
3 ccsbBroad304_10435 pLX_304 0% 99.8% 99.7% V5 147C>T;2376_2377delTGinsNN n/a
4 TRCN0000491480 GAATACGCGCGTGTCACATCCGTC pLX_317 13.3% 94.9% 94.8% V5 (not translated due to prior stop codon) 1890_2009del n/a
5 TRCN0000489943 TGACGAGCTTCAAAACAAGCCACG pLX_317 18.8% 94.9% 94.7% V5 1890_2009del;2379_2380insG n/a
Download CSV