Transcript: Human NM_002338.5

Homo sapiens limbic system associated membrane protein (LSAMP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
LSAMP (4045)
Length:
9416
CDS:
457..1473

Additional Resources:

NCBI RefSeq record:
NM_002338.5
NBCI Gene record:
LSAMP (4045)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002338.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063933 CCGGGATGACACTAGGATAAA pLKO.1 1212 CDS 100% 13.200 18.480 N LSAMP n/a
2 TRCN0000415355 GACGACAAGCTTCACTCAAAT pLKO_005 1151 CDS 100% 13.200 18.480 N LSAMP n/a
3 TRCN0000063935 CAAGTTTACTTGATCGTACAA pLKO.1 823 CDS 100% 4.950 6.930 N LSAMP n/a
4 TRCN0000420281 AGCCACTTCAGACTATCAATG pLKO_005 1951 3UTR 100% 10.800 8.640 N LSAMP n/a
5 TRCN0000435923 TGAACCGTTCTGGCATCATTT pLKO_005 650 CDS 100% 13.200 9.240 N LSAMP n/a
6 TRCN0000063937 CTGTGAACTATCCTCCCACTA pLKO.1 1097 CDS 100% 4.050 2.835 N LSAMP n/a
7 TRCN0000063934 CGGTGAGAGGAATAAATGGAT pLKO.1 1385 CDS 100% 3.000 2.100 N LSAMP n/a
8 TRCN0000063936 CTACTGAGATTGCTCTGCCTT pLKO.1 502 CDS 100% 2.640 1.848 N LSAMP n/a
9 TRCN0000113577 GTTTACTTGATCGTACAAGTT pLKO.1 826 CDS 100% 0.495 0.347 N Lsamp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002338.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000472018 TATCCGCCCTAGCGAGGCCAACTT pLX_317 28.1% 99.7% 99.7% V5 69_71delTCCinsCAG n/a
Download CSV