Construct: ORF TRCN0000472018
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014963.1_s317c1
- Derived from:
- BRDN0000388108
- DNA Barcode:
- TATCCGCCCTAGCGAGGCCAACTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LSAMP (4045)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472018
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4045 | LSAMP | limbic system associated me... | NM_002338.5 | 99.7% | 99.7% | 69_71delTCCinsCAG |
2 | human | 4045 | LSAMP | limbic system associated me... | XM_017006383.2 | 96.2% | 96% | 69_71delTCCinsCAG;920_955del |
3 | human | 4045 | LSAMP | limbic system associated me... | NM_001318915.2 | 93.3% | 93% | 69_71delTCCinsCAG;920_988del |
4 | human | 4045 | LSAMP | limbic system associated me... | XM_011512840.3 | 90.7% | 87.5% | (many diffs) |
5 | human | 4045 | LSAMP | limbic system associated me... | XM_024453521.1 | 69.2% | 62.2% | (many diffs) |
6 | human | 4045 | LSAMP | limbic system associated me... | XM_024453520.1 | 64.8% | 58.1% | (many diffs) |
7 | human | 4045 | LSAMP | limbic system associated me... | XM_017006384.2 | 47.8% | 46.2% | (many diffs) |
8 | human | 4045 | LSAMP | limbic system associated me... | XM_024453522.1 | 47.8% | 46.2% | (many diffs) |
9 | mouse | 268890 | Lsamp | limbic system-associated me... | NM_001347236.1 | 93.8% | 98.2% | (many diffs) |
10 | mouse | 268890 | Lsamp | limbic system-associated me... | XM_006522201.3 | 87.9% | 91.6% | (many diffs) |
11 | mouse | 268890 | Lsamp | limbic system-associated me... | NM_175548.3 | 87.1% | 88.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1080
- ORF length:
- 1014
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt caggagagtt cagccggatc ggaaacagtt gccactggtc ctactgagat 121 tgctctgcct tctcagcaca ggactgcctg ttcgcagcgt ggattttaac cgaggcacgg 181 acaacatcac cgtgaggcag ggggacacag ccatcctcag gtgcgttgta gaagacaaga 241 actcaaaggt ggcctggttg aaccgttctg gcatcatttt tgctggacat gacaagtggt 301 ctctggaccc acgggttgag ctggagaaac gccattctct ggaatacagc ctccgaatcc 361 agaaggtgga tgtctatgat gagggttcct acacttgctc agttcagaca cagcatgagc 421 ccaagacctc ccaagtttac ttgatcgtac aagtcccacc aaagatctcc aatatctcct 481 cggatgtcac tgtgaatgag ggcagcaacg tgactctggt ctgcatggcc aatggccgtc 541 ctgaacctgt tatcacctgg agacacctta caccaactgg aagggaattt gaaggagaag 601 aagaatatct ggagatcctt ggcatcacca gggagcagtc aggcaaatat gagtgcaaag 661 ctgccaacga ggtctcctcg gcggatgtca aacaagtcaa ggtcactgtg aactatcctc 721 ccactatcac agaatccaag agcaatgaag ccaccacagg acgacaagct tcactcaaat 781 gtgaggcctc ggcagtgccT GCACCTGACT TTGAGTGGTA CCGGGATGAC ACTAGGATAA 841 ATAGTGCCAA TGGCCTTGAG ATTAAGAGCA CGGAGGGCCA GTCTTCCCTG ACGGTGACCA 901 ACGTCACTGA GGAGCACTAC GGCAACTACA CCTGTGTGGC TGCCAACAAG CTGGGGGTCA 961 CCAATGCCAG CCTAGTCCTT TTCAGACCTG GGTCGGTGAG AGGAATAAAT GGATCCATCA 1021 GTCTGGCCGT ACCACTGTGG CTGCTGGCAG CATCTCTGCT CTGCCTTCTC AGCAAATGTT 1081 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1141 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1201 TTTATATATC TTGTGGAAAG GACGATATCC GCCCTAGCGA GGCCAACTTA CGCGTTAAGT 1261 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt