Transcript: Human NM_002361.4

Homo sapiens myelin associated glycoprotein (MAG), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
MAG (4099)
Length:
2357
CDS:
124..2004

Additional Resources:

NCBI RefSeq record:
NM_002361.4
NBCI Gene record:
MAG (4099)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002361.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244102 TTGCCATCGTCTGCTACATTA pLKO_005 1703 CDS 100% 13.200 18.480 N MAG n/a
2 TRCN0000244103 ATGGTGTCTGGTACTTCAATA pLKO_005 290 CDS 100% 13.200 9.240 N MAG n/a
3 TRCN0000179256 GCTAGCTGAGTATGCTGAAAT pLKO.1 1971 CDS 100% 13.200 9.240 N MAG n/a
4 TRCN0000244101 GCTAGCTGAGTATGCTGAAAT pLKO_005 1971 CDS 100% 13.200 9.240 N MAG n/a
5 TRCN0000244104 CCAACAGTGAACGGGACAATG pLKO_005 1108 CDS 100% 10.800 7.560 N MAG n/a
6 TRCN0000244100 GTGTGGCTGAGAACCAGTATG pLKO_005 1298 CDS 100% 10.800 7.560 N MAG n/a
7 TRCN0000183999 CTTCAACCTGTCTGTGGAGTT pLKO.1 1335 CDS 100% 4.050 2.835 N MAG n/a
8 TRCN0000196036 GAGCTAGCTGAGTATGCTGAA pLKO.1 1969 CDS 100% 4.050 2.835 N MAG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002361.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06550 pDONR223 100% 99.8% 100% None 399C>T;1209C>T n/a
2 ccsbBroad304_06550 pLX_304 0% 99.8% 100% V5 399C>T;1209C>T n/a
3 TRCN0000478714 GTAAAGATAGCATCACTTCAATGT pLX_317 20.1% 99.8% 100% V5 399C>T;1209C>T n/a
Download CSV