Transcript: Human NM_002433.5

Homo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant beta1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MOG (4340)
Length:
1792
CDS:
119..877

Additional Resources:

NCBI RefSeq record:
NM_002433.5
NBCI Gene record:
MOG (4340)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002433.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148309 CCGAGATCATTCTTACCAAGA pLKO.1 505 CDS 100% 4.050 5.670 N MOG n/a
2 TRCN0000373012 TCAGAGTATCCACTGTTTATT pLKO_005 1343 3UTR 100% 15.000 10.500 N MOG n/a
3 TRCN0000373011 GCTGGAAGATAACCCTGTTTG pLKO_005 735 CDS 100% 10.800 7.560 N MOG n/a
4 TRCN0000373067 TGAGCTGAAGAGTGAGGATAT pLKO_005 1108 3UTR 100% 10.800 7.560 N MOG n/a
5 TRCN0000373068 TTCGAGCAGAGATAGAGAATC pLKO_005 675 CDS 100% 10.800 7.560 N MOG n/a
6 TRCN0000149025 GATGAAGTGGAATTGCCATGT pLKO.1 257 CDS 100% 4.050 2.835 N MOG n/a
7 TRCN0000149862 GCAATTCCTTGAAGAGCTACT pLKO.1 829 CDS 100% 4.050 2.835 N MOG n/a
8 TRCN0000148588 CTGCTGAAAGATGCTATTGGT pLKO.1 416 CDS 100% 3.000 2.100 N MOG n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1453 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1454 3UTR 100% 13.200 6.600 Y LIAS n/a
11 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1619 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002433.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10974 pDONR223 100% 82.5% 82.3% None (many diffs) n/a
2 TRCN0000480215 CGTAATGACCTGCTCAATACACAG pLX_317 48.2% 82.5% 82.3% V5 (many diffs) n/a
Download CSV