Transcript: Human NM_002452.3

Homo sapiens nudix hydrolase 1 (NUDT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NUDT1 (4521)
Length:
692
CDS:
48..518

Additional Resources:

NCBI RefSeq record:
NM_002452.3
NBCI Gene record:
NUDT1 (4521)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002452.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050130 CCCGACGACAGCTACTGGTTT pLKO.1 399 CDS 100% 1.650 2.310 N NUDT1 n/a
2 TRCN0000288946 CCCGACGACAGCTACTGGTTT pLKO_005 399 CDS 100% 1.650 2.310 N NUDT1 n/a
3 TRCN0000050132 CGAGTTCTCCTGGGCATGAAA pLKO.1 96 CDS 100% 5.625 3.938 N NUDT1 n/a
4 TRCN0000306995 CGAGTTCTCCTGGGCATGAAA pLKO_005 96 CDS 100% 5.625 3.938 N NUDT1 n/a
5 TRCN0000050131 CCTGAGCTCATGGACGTGCAT pLKO.1 279 CDS 100% 0.880 0.616 N NUDT1 n/a
6 TRCN0000288947 CCTGAGCTCATGGACGTGCAT pLKO_005 279 CDS 100% 0.880 0.616 N NUDT1 n/a
7 TRCN0000050129 CCTGCTTCAGAAGAAGAAATT pLKO.1 425 CDS 100% 13.200 7.920 N NUDT1 n/a
8 TRCN0000288945 CCTGCTTCAGAAGAAGAAATT pLKO_005 425 CDS 100% 13.200 7.920 N NUDT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002452.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01047 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01047 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492162 GATGTCGTGGGCACATTGCCTGAG pLX_317 76.1% 100% 100% V5 n/a
4 ccsbBroadEn_01046 pDONR223 100% 87.1% 87.1% None 0_1ins69 n/a
5 ccsbBroad304_01046 pLX_304 0% 87.1% 87.1% V5 0_1ins69 n/a
6 TRCN0000468026 GCGGTGTGAGGCCTTATGTCGGAT pLX_317 78% 87.1% 87.1% V5 0_1ins69 n/a
Download CSV