Transcript: Human NM_002510.3

Homo sapiens glycoprotein nmb (GPNMB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
GPNMB (10457)
Length:
2650
CDS:
84..1766

Additional Resources:

NCBI RefSeq record:
NM_002510.3
NBCI Gene record:
GPNMB (10457)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002510.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154721 GCTGCAAGATTGCCACTTGAT pLKO.1 123 CDS 100% 4.950 6.930 N GPNMB n/a
2 TRCN0000178982 CGCACAAGTGAAAGATGTGTA pLKO.1 752 CDS 100% 4.950 3.960 N GPNMB n/a
3 TRCN0000151539 GCCATGTTGTGAAACTGATAA pLKO.1 1953 3UTR 100% 13.200 9.240 N GPNMB n/a
4 TRCN0000151637 CACAAGGAATACAACCCAATA pLKO.1 1611 CDS 100% 10.800 7.560 N GPNMB n/a
5 TRCN0000179643 GCAACTTAGCAAGGCTTCTTT pLKO.1 1976 3UTR 100% 5.625 3.938 N GPNMB n/a
6 TRCN0000196106 GTGTCTTTCTCAACCGTGCAA pLKO.1 1672 CDS 100% 2.640 1.848 N GPNMB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002510.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07611 pDONR223 100% 97.7% 97.7% None 1016_1017ins36;1461T>C;1676T>C n/a
2 ccsbBroad304_07611 pLX_304 0% 97.7% 97.7% V5 1016_1017ins36;1461T>C;1676T>C n/a
3 TRCN0000476975 GAACGCTGGATAAGAGAAATAGTC pLX_317 18.7% 97.7% 97.7% V5 1016_1017ins36;1461T>C;1676T>C n/a
4 ccsbBroadEn_15712 pDONR223 0% 35.8% 32.6% None (many diffs) n/a
5 ccsbBroad304_15712 pLX_304 0% 35.8% 32.6% V5 (many diffs) n/a
6 TRCN0000480884 TCGGCTATGGGGTGTTTAACATCA pLX_317 76.4% 35.8% 32.6% V5 (many diffs) n/a
Download CSV