Transcript: Human NM_002514.4

Homo sapiens cellular communication network factor 3 (CCN3), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
CCN3 (4856)
Length:
2463
CDS:
88..1161

Additional Resources:

NCBI RefSeq record:
NM_002514.4
NBCI Gene record:
CCN3 (4856)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002514.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373105 CACCAATAGGAACCGTCAATG pLKO_005 771 CDS 100% 10.800 15.120 N CCN3 n/a
2 TRCN0000107131 CGCACCAAGAAGTCACTCAAA pLKO.1 883 CDS 100% 4.950 3.960 N CCN3 n/a
3 TRCN0000107130 CCCACCATCAAAGGAATATAA pLKO.1 1211 3UTR 100% 15.000 10.500 N CCN3 n/a
4 TRCN0000373046 CCAGAGCAGCCAACAGATAAG pLKO_005 844 CDS 100% 10.800 7.560 N CCN3 n/a
5 TRCN0000373107 TCAAGTGTCAACTGCATTGAA pLKO_005 691 CDS 100% 5.625 3.938 N CCN3 n/a
6 TRCN0000107132 CCCAGGGCAAATAGTCAAGAA pLKO.1 1035 CDS 100% 4.950 3.465 N CCN3 n/a
7 TRCN0000107133 CTGTCACACCAACTGTCCTAA pLKO.1 1083 CDS 100% 4.950 3.465 N CCN3 n/a
8 TRCN0000107134 AGAGGGAGATAACTGTGTGTT pLKO.1 402 CDS 100% 4.950 2.475 Y CCN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002514.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06651 pDONR223 100% 99.9% 99.7% None 291C>A n/a
2 ccsbBroad304_06651 pLX_304 0% 99.9% 99.7% V5 291C>A n/a
3 TRCN0000473880 GAATGAGCGGACGAAGTTAATGTA pLX_317 48.9% 99.9% 99.7% V5 291C>A n/a
Download CSV