Transcript: Human NM_002546.4

Homo sapiens TNF receptor superfamily member 11b (TNFRSF11B), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
TNFRSF11B (4982)
Length:
2087
CDS:
65..1270

Additional Resources:

NCBI RefSeq record:
NM_002546.4
NBCI Gene record:
TNFRSF11B (4982)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002546.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038739 CCTCCAAAGTACCTTCATTAT pLKO.1 137 CDS 100% 13.200 18.480 N TNFRSF11B n/a
2 TRCN0000038741 GCACTCAAAGACGTACCACTT pLKO.1 1114 CDS 100% 4.050 5.670 N TNFRSF11B n/a
3 TRCN0000038743 CGTAGCTTGATGGAAAGCTTA pLKO.1 950 CDS 100% 0.495 0.693 N TNFRSF11B n/a
4 TRCN0000038742 GCTTAGTGTCTTGGTAGACAA pLKO.1 721 CDS 100% 0.495 0.396 N TNFRSF11B n/a
5 TRCN0000331187 GCTTAGTGTCTTGGTAGACAA pLKO_005 721 CDS 100% 0.495 0.396 N TNFRSF11B n/a
6 TRCN0000370067 CTCATTACCAGTGACTAATTT pLKO_005 1367 3UTR 100% 15.000 10.500 N TNFRSF11B n/a
7 TRCN0000038740 GCTCAGTTTGTGGCGAATAAA pLKO.1 1048 CDS 100% 15.000 10.500 N TNFRSF11B n/a
8 TRCN0000298918 GCTCAGTTTGTGGCGAATAAA pLKO_005 1048 CDS 100% 15.000 10.500 N TNFRSF11B n/a
9 TRCN0000308034 TCGTTATCTACTGACTATATT pLKO_005 1482 3UTR 100% 15.000 10.500 N TNFRSF11B n/a
10 TRCN0000296001 ATGCAACACACGACAACATAT pLKO_005 597 CDS 100% 13.200 9.240 N TNFRSF11B n/a
11 TRCN0000308036 TAACCAGGTCCAATCAGTAAA pLKO_005 1234 CDS 100% 13.200 9.240 N TNFRSF11B n/a
12 TRCN0000370026 TCAAATGAGACGTCATCTAAA pLKO_005 515 CDS 100% 13.200 9.240 N TNFRSF11B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002546.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01120 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01120 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479567 TTGTATTCCATTTCTCTCCGCTTT pLX_317 27.8% 100% 100% V5 n/a
Download CSV