Transcript: Human NM_002556.3

Homo sapiens oxysterol binding protein (OSBP), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
OSBP (5007)
Length:
4713
CDS:
111..2534

Additional Resources:

NCBI RefSeq record:
NM_002556.3
NBCI Gene record:
OSBP (5007)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155752 CGCGGAGATAACTGCGATATT pLKO.1 3082 3UTR 100% 13.200 18.480 N OSBP n/a
2 TRCN0000155602 CGAGCCACACTCTTTAGGATA pLKO.1 891 CDS 100% 4.950 6.930 N OSBP n/a
3 TRCN0000152357 CCGAATTTAGAAGTTCCCTTA pLKO.1 2949 3UTR 100% 4.050 2.835 N OSBP n/a
4 TRCN0000150396 CATCTGAAAGCTAGTTCAGAA pLKO.1 588 CDS 100% 0.495 0.347 N OSBP n/a
5 TRCN0000155000 GCTCAGACCTACCATCTGAAA pLKO.1 576 CDS 100% 0.495 0.347 N OSBP n/a
6 TRCN0000151689 CAACATTATTGTGGGCAAGTT pLKO.1 1859 CDS 100% 4.950 2.970 N OSBP n/a
7 TRCN0000251259 CATCCAATGCCATGATCAATG pLKO_005 913 CDS 100% 10.800 6.480 N Osbp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14725 pDONR223 87.4% 99.8% 22.8% None 549_550insG;1579_1580insA;1711_1712insT n/a
2 ccsbBroad304_14725 pLX_304 0% 99.8% 22.8% V5 (not translated due to prior stop codon) 549_550insG;1579_1580insA;1711_1712insT n/a
3 TRCN0000477852 GCTGCAAGAAGAAAACGAGCGTAA pLX_317 10% 99.8% 22.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV