Transcript: Human NM_002601.4

Homo sapiens phosphodiesterase 6D (PDE6D), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PDE6D (5147)
Length:
1140
CDS:
169..621

Additional Resources:

NCBI RefSeq record:
NM_002601.4
NBCI Gene record:
PDE6D (5147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002601.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048850 GTGATCCCTAACTCCACAAAT pLKO.1 457 CDS 100% 13.200 18.480 N PDE6D n/a
2 TRCN0000290635 GTGATCCCTAACTCCACAAAT pLKO_005 457 CDS 100% 13.200 18.480 N PDE6D n/a
3 TRCN0000296660 TGATGCCAGCAAGCGTCTTAA pLKO_005 518 CDS 100% 13.200 9.240 N PDE6D n/a
4 TRCN0000296661 TTCCAGCTGACCAGACTAAAC pLKO_005 814 3UTR 100% 10.800 7.560 N PDE6D n/a
5 TRCN0000048849 GCACATCCAGAGTGAGACTTT pLKO.1 590 CDS 100% 4.950 3.465 N PDE6D n/a
6 TRCN0000290577 GCACATCCAGAGTGAGACTTT pLKO_005 590 CDS 100% 4.950 3.465 N PDE6D n/a
7 TRCN0000048852 GCAATGCCTAGAAGAATGGTT pLKO.1 420 CDS 100% 3.000 2.100 N PDE6D n/a
8 TRCN0000290576 GCAATGCCTAGAAGAATGGTT pLKO_005 420 CDS 100% 3.000 2.100 N PDE6D n/a
9 TRCN0000048851 ACAGGGAAGATACTCTGGCAA pLKO.1 247 CDS 100% 2.640 1.848 N PDE6D n/a
10 TRCN0000114885 GCTTCAAACTAAATTGGATGA pLKO.1 209 CDS 100% 4.050 2.430 N Pde6d n/a
11 TRCN0000332322 GCTTCAAACTAAATTGGATGA pLKO_005 209 CDS 100% 4.050 2.430 N Pde6d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002601.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01158 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01158 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468394 TGCAGCTTTACAACATGCACTCTG pLX_317 64.6% 100% 100% V5 n/a
Download CSV