Transcript: Human NM_002622.5

Homo sapiens prefoldin subunit 1 (PFDN1), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PFDN1 (5201)
Length:
1336
CDS:
29..397

Additional Resources:

NCBI RefSeq record:
NM_002622.5
NBCI Gene record:
PFDN1 (5201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002622.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323335 CACGCCAGCCAGACCAATAAA pLKO_005 700 3UTR 100% 15.000 21.000 N PFDN1 n/a
2 TRCN0000219037 AGAGCTTCAAGCCAAAGTTAT pLKO_005 70 CDS 100% 13.200 9.240 N Pfdn1 n/a
3 TRCN0000323337 AGAGCTTCAAGCCAAAGTTAT pLKO_005 70 CDS 100% 13.200 9.240 N PFDN1 n/a
4 TRCN0000323255 AGCTCGCAGACATACAGATTG pLKO_005 111 CDS 100% 10.800 7.560 N PFDN1 n/a
5 TRCN0000323336 CTACCTGGAGCGAAGCGTTAA pLKO_005 325 CDS 100% 10.800 7.560 N PFDN1 n/a
6 TRCN0000019008 CTTCAGTCCAAGGAAGCAATT pLKO.1 236 CDS 100% 10.800 7.560 N PFDN1 n/a
7 TRCN0000323254 CTTCAGTCCAAGGAAGCAATT pLKO_005 236 CDS 100% 10.800 7.560 N PFDN1 n/a
8 TRCN0000019005 CAGAGCTTCAAGCCAAAGTTA pLKO.1 69 CDS 100% 5.625 3.938 N PFDN1 n/a
9 TRCN0000019007 GAACAGCTAAACAGAACGAAA pLKO.1 131 CDS 100% 4.950 3.465 N PFDN1 n/a
10 TRCN0000019004 GCCAAAGTTATTGACACTCAA pLKO.1 80 CDS 100% 4.950 3.465 N PFDN1 n/a
11 TRCN0000019006 CGTTAAGGAAGCTGAGGACAA pLKO.1 340 CDS 100% 4.050 2.835 N PFDN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002622.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01177 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01177 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474721 GCGCCAGCTAGCTGGGGCACACGG pLX_317 100% 100% 100% V5 n/a
Download CSV