Transcript: Human NM_002630.4

Homo sapiens progastricsin (PGC), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PGC (5225)
Length:
1371
CDS:
64..1230

Additional Resources:

NCBI RefSeq record:
NM_002630.4
NBCI Gene record:
PGC (5225)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002630.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051848 CCCACAAGTATGATCCTGCTT pLKO.1 197 CDS 100% 2.640 3.696 N PGC n/a
2 TRCN0000373195 CTGCCACCTTCCTCCTATATC pLKO_005 1051 CDS 100% 13.200 9.240 N PGC n/a
3 TRCN0000373196 TCTTCCTCAGGTCCTACTATT pLKO_005 1160 CDS 100% 13.200 9.240 N PGC n/a
4 TRCN0000051852 CAGGAACTCTACTGGCAGATT pLKO.1 799 CDS 100% 4.950 3.465 N PGC n/a
5 TRCN0000051851 GAACTGTAACAGCATTCAGAA pLKO.1 987 CDS 100% 4.950 3.465 N PGC n/a
6 TRCN0000051849 CAGCAGTACATGAGTGCTCTT pLKO.1 919 CDS 100% 4.050 2.835 N PGC n/a
7 TRCN0000051850 CCTGGTACCAACTTCGTCTAT pLKO.1 562 CDS 100% 0.000 0.000 N PGC n/a
8 TRCN0000378948 CTGAAGAAATTTAAGTCTATC pLKO_005 130 CDS 100% 10.800 6.480 N PGC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002630.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11029 pDONR223 100% 26.3% 25% None (many diffs) n/a
2 ccsbBroad304_11029 pLX_304 0% 26.3% 25% V5 (many diffs) n/a
3 TRCN0000465763 AGGGTAACTTACCGACTCCGGGCT pLX_317 84.9% 26.3% 25% V5 (many diffs) n/a
4 TRCN0000487898 ATGACGTATACCCGCATGTTATTG pLX_317 83.5% 26.3% 25% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV