Transcript: Human NM_002639.5

Homo sapiens serpin family B member 5 (SERPINB5), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
SERPINB5 (5268)
Length:
2586
CDS:
96..1223

Additional Resources:

NCBI RefSeq record:
NM_002639.5
NBCI Gene record:
SERPINB5 (5268)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002639.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373505 AGCGGCTCTACGTAGACAAAT pLKO_005 364 CDS 100% 13.200 18.480 N SERPINB5 n/a
2 TRCN0000052298 GCCGTTGATCTGTTCAAACAA pLKO.1 129 CDS 100% 5.625 7.875 N SERPINB5 n/a
3 TRCN0000373443 GCACATGCTCAGGCTACTATA pLKO_005 1699 3UTR 100% 13.200 10.560 N SERPINB5 n/a
4 TRCN0000373444 CAGATCAACAACTCAATTAAG pLKO_005 486 CDS 100% 13.200 9.240 N SERPINB5 n/a
5 TRCN0000052299 CCACAAAGTGTGCTTAGAAAT pLKO.1 1052 CDS 100% 13.200 9.240 N SERPINB5 n/a
6 TRCN0000052302 CCATCCCTTTATTTACATCAT pLKO.1 1148 CDS 100% 4.950 3.465 N SERPINB5 n/a
7 TRCN0000052301 CCTTGTGGTTAATGCTGCCTA pLKO.1 572 CDS 100% 2.640 1.848 N SERPINB5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002639.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11030 pDONR223 100% 57.8% 48.3% None (many diffs) n/a
2 ccsbBroad304_11030 pLX_304 0% 57.8% 48.3% V5 (many diffs) n/a
3 TRCN0000480196 AGCAAGTAACTTACTATGCGCCTT pLX_317 37.4% 57.8% 48.3% V5 (many diffs) n/a
4 TRCN0000488523 AAGGACTGTATTGCCTAGTGAACC pLX_317 46.1% 57.8% 48.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV