Transcript: Human NM_002728.6

Homo sapiens proteoglycan 2, pro eosinophil major basic protein (PRG2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PRG2 (5553)
Length:
1431
CDS:
68..736

Additional Resources:

NCBI RefSeq record:
NM_002728.6
NBCI Gene record:
PRG2 (5553)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002728.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436237 AGGGTCAAGTCTGGATTGGAG pLKO_005 528 CDS 100% 2.640 3.696 N PRG2 n/a
2 TRCN0000417676 AGACGCTTTCAGTGGGTTGAC pLKO_005 575 CDS 100% 4.050 3.240 N PRG2 n/a
3 TRCN0000062342 AGTCTTCAGACGTTTAGTCAA pLKO.1 407 CDS 100% 4.950 3.465 N PRG2 n/a
4 TRCN0000062338 CCTGGTTTCCATCCACAACTT pLKO.1 463 CDS 100% 4.950 3.465 N PRG2 n/a
5 TRCN0000062340 CTGAGGAAGAGGACACAGTAA pLKO.1 336 CDS 100% 4.950 3.465 N PRG2 n/a
6 TRCN0000062341 GAAGACTTCCTTTCATCTGTT pLKO.1 708 CDS 100% 4.950 3.465 N PRG2 n/a
7 TRCN0000062339 AGTGCCAGATATGGTGGACAA pLKO.1 301 CDS 100% 4.050 2.835 N PRG2 n/a
8 TRCN0000421667 TTTACTTGCCGGAGGTGCTAC pLKO_005 434 CDS 100% 4.050 2.835 N PRG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002728.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06767 pDONR223 100% 99.5% 99.5% None 13T>C;549A>G;616C>T n/a
2 ccsbBroad304_06767 pLX_304 0% 99.5% 99.5% V5 13T>C;549A>G;616C>T n/a
3 TRCN0000491444 CGAATCGACCCGTTCATGTGCATG pLX_317 53.9% 99.5% 99.5% V5 13T>C;549A>G;616C>T n/a
Download CSV