Transcript: Human NM_002738.7

Homo sapiens protein kinase C beta (PRKCB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PRKCB (5579)
Length:
8010
CDS:
194..2215

Additional Resources:

NCBI RefSeq record:
NM_002738.7
NBCI Gene record:
PRKCB (5579)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145137 TGACGTGGAGTGCACTATGG pXPR_003 TGG 1162 57% 10 1.0043 PRKCB PRKCB 75956
2 BRDN0001148507 CTTGCTGGATGTGATACATG pXPR_003 AGG 1286 64% 11 0.8262 PRKCB PRKCB 75954
3 BRDN0001144990 CCACAGTGGTCACAAAACGT pXPR_003 GGG 339 17% 4 0.2788 PRKCB PRKCB 75955
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002738.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012455 CCGGATGAAACTGACCGATTT pLKO.1 1198 CDS 100% 10.800 15.120 N Prkcb n/a
2 TRCN0000003119 CCGGTATATTGATTGGGAGAA pLKO.1 1993 CDS 100% 4.050 5.670 N PRKCB n/a
3 TRCN0000417211 ACCTGAAGGCGAACGTGATAT pLKO_005 1954 CDS 100% 13.200 9.240 N PRKCB n/a
4 TRCN0000426726 ATGAAGAACTGCGGCAGAAAT pLKO_005 1086 CDS 100% 13.200 9.240 N PRKCB n/a
5 TRCN0000435447 ATGAGGTCAAGAACCACAAAT pLKO_005 288 CDS 100% 13.200 9.240 N PRKCB n/a
6 TRCN0000429004 GACCAACACTGTCTCCAAATT pLKO_005 1156 CDS 100% 13.200 9.240 N PRKCB n/a
7 TRCN0000196841 GACGACCTGCTTTGATTTAAC pLKO.1 3126 3UTR 100% 13.200 9.240 N PRKCB n/a
8 TRCN0000195381 CCTGTCAGATCCCTACGTAAA pLKO.1 763 CDS 100% 10.800 7.560 N PRKCB n/a
9 TRCN0000196399 GAAACAAAGATGGTTGTATTC pLKO.1 3268 3UTR 100% 10.800 7.560 N PRKCB n/a
10 TRCN0000196323 GCCATGAATTTGTCACATTCT pLKO.1 426 CDS 100% 4.950 3.465 N PRKCB n/a
11 TRCN0000003117 GCTGAAAGAATCGGACAAAGA pLKO.1 883 CDS 100% 4.950 3.465 N PRKCB n/a
12 TRCN0000003118 CAAGTTTAAGATCCACACGTA pLKO.1 499 CDS 100% 2.640 1.848 N PRKCB n/a
13 TRCN0000003116 CTATCCCAAGTCTATGTCCAA pLKO.1 1870 CDS 100% 2.640 1.848 N PRKCB n/a
14 TRCN0000195045 CCCGAGATAATTGCTTATCAG pLKO.1 1721 CDS 100% 0.495 0.347 N PRKCB n/a
15 TRCN0000012457 CCAATCAGAATTCGAAGGATT pLKO.1 2149 CDS 100% 0.000 0.000 N Prkcb n/a
16 TRCN0000195733 CGTCCTTCATTTCTGTCATTC pLKO.1 2233 3UTR 100% 10.800 6.480 N PRKCB n/a
17 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7056 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002738.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01282 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01282 pLX_304 21% 100% 100% V5 n/a
3 TRCN0000481367 ACAAAATTCATGAGACGGCGACCG pLX_317 20.8% 100% 100% V5 n/a
4 ccsbBroadEn_14789 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14789 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000480223 GGTCTACGGACGGTGCGACGAGTG pLX_317 19.6% 100% 100% V5 n/a
7 TRCN0000488865 GGTTCCGGATAACAGTCTTTCTTT pLX_317 18.7% 99.9% 100% V5 (not translated due to prior stop codon) 1191T>C n/a
8 TRCN0000489742 CCCTCCTTCCGAGTCAGGAGGATA pLX_317 18.5% 99.9% 99.8% V5 1191T>C;2019_2020insG n/a
Download CSV