Transcript: Human NM_002830.4

Homo sapiens protein tyrosine phosphatase non-receptor type 4 (PTPN4), mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
PTPN4 (5775)
Length:
11090
CDS:
481..3261

Additional Resources:

NCBI RefSeq record:
NM_002830.4
NBCI Gene record:
PTPN4 (5775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002830.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350905 ATGATGCCACACGGGTCATTT pLKO_005 2552 CDS 100% 13.200 18.480 N PTPN4 n/a
2 TRCN0000002794 CGTCATCAACACAAGCTAATA pLKO.1 1793 CDS 100% 13.200 18.480 N PTPN4 n/a
3 TRCN0000338347 CGTCATCAACACAAGCTAATA pLKO_005 1793 CDS 100% 13.200 18.480 N PTPN4 n/a
4 TRCN0000379511 GATCCAAACACCTAGTCAATA pLKO_005 3162 CDS 100% 13.200 10.560 N PTPN4 n/a
5 TRCN0000338349 GAGCCAGATTTCCAGTATATT pLKO_005 2329 CDS 100% 15.000 10.500 N PTPN4 n/a
6 TRCN0000002791 GCTCCGAACAAATAGTAAATA pLKO.1 3475 3UTR 100% 15.000 10.500 N PTPN4 n/a
7 TRCN0000338350 TGAGTATGTTCAGGGTAATTT pLKO_005 3498 3UTR 100% 15.000 10.500 N PTPN4 n/a
8 TRCN0000382110 TGCTCGCAGGAAATGGCATTT pLKO_005 3329 3UTR 100% 10.800 7.560 N PTPN4 n/a
9 TRCN0000029900 CCTCTCAGATTATTCTTTCAT pLKO.1 990 CDS 100% 5.625 3.938 N Ptpn4 n/a
10 TRCN0000002790 CCCTGATGATTCGAGTGACTT pLKO.1 2949 CDS 100% 4.950 3.465 N PTPN4 n/a
11 TRCN0000002793 GCTGTATATGATGTAGTGGAA pLKO.1 2293 CDS 100% 2.640 1.848 N PTPN4 n/a
12 TRCN0000338290 GCTGTATATGATGTAGTGGAA pLKO_005 2293 CDS 100% 2.640 1.848 N PTPN4 n/a
13 TRCN0000002792 CCTTCTAATACTGCTGCCCTT pLKO.1 904 CDS 100% 2.160 1.512 N PTPN4 n/a
14 TRCN0000029903 GCAAATAAAGACAGGGTATTT pLKO.1 1525 CDS 100% 1.320 0.924 N Ptpn4 n/a
15 TRCN0000276888 ATGTTCACTGTGCCATAATAC pLKO_005 3308 3UTR 100% 13.200 9.240 N Ptpn4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002830.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01341 pDONR223 100% 100% 100% None n/a
Download CSV