Transcript: Human NM_002862.4

Homo sapiens glycogen phosphorylase B (PYGB), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PYGB (5834)
Length:
4116
CDS:
95..2626

Additional Resources:

NCBI RefSeq record:
NM_002862.4
NBCI Gene record:
PYGB (5834)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002862.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153819 CGTGAAACAGTCGGTCTTTAA pLKO.1 1483 CDS 100% 13.200 18.480 N PYGB n/a
2 TRCN0000157479 GATCGTGAAACAGTCGGTCTT pLKO.1 1480 CDS 100% 4.050 5.670 N PYGB n/a
3 TRCN0000281102 GATCGTGAAACAGTCGGTCTT pLKO_005 1480 CDS 100% 4.050 5.670 N PYGB n/a
4 TRCN0000153339 GCTATGGAATCCGCTATGAAT pLKO.1 564 CDS 100% 5.625 4.500 N PYGB n/a
5 TRCN0000281094 GCTATGGAATCCGCTATGAAT pLKO_005 564 CDS 100% 5.625 4.500 N PYGB n/a
6 TRCN0000152444 CAAGGTCAAACAGGAGAACAA pLKO.1 1702 CDS 100% 4.950 3.960 N PYGB n/a
7 TRCN0000153891 CAAGAAGGTCATCAGGAACAT pLKO.1 2491 CDS 100% 4.950 3.465 N PYGB n/a
8 TRCN0000158010 CACGAAGAAGACCTGTGCATA pLKO.1 1198 CDS 100% 4.950 3.465 N PYGB n/a
9 TRCN0000281026 CACGAAGAAGACCTGTGCATA pLKO_005 1198 CDS 100% 4.950 3.465 N PYGB n/a
10 TRCN0000153652 CCAGAACTTTGCACACATCTT pLKO.1 2934 3UTR 100% 4.950 3.465 N PYGB n/a
11 TRCN0000281028 CCAGAACTTTGCACACATCTT pLKO_005 2934 3UTR 100% 4.950 3.465 N PYGB n/a
12 TRCN0000157576 GTGAACATGCTGATGCACCAT pLKO.1 2381 CDS 100% 2.640 1.848 N PYGB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002862.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01354 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01354 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480378 CGCTCAATGTCCTCACGCTCAAGT pLX_317 15.6% 100% 100% V5 n/a
4 TRCN0000488953 AACGGCTTCCAACTAGCTATTCCA pLX_317 14.6% 99.9% 99.8% V5 1146T>C;2529_2530insG n/a
5 TRCN0000489102 TAACCAATGCGCTCTTCTCTCACT pLX_317 4.1% 99.6% 100% V5 (not translated due to prior stop codon) 2529_2530insTAGCAGCT n/a
Download CSV