Transcript: Human NM_002887.4

Homo sapiens arginyl-tRNA synthetase 1 (RARS1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RARS1 (5917)
Length:
2122
CDS:
29..2011

Additional Resources:

NCBI RefSeq record:
NM_002887.4
NBCI Gene record:
RARS1 (5917)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002887.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045429 CCATACCATTAACCATAGTAA pLKO.1 1137 CDS 100% 5.625 7.875 N RARS1 n/a
2 TRCN0000315733 CCATACCATTAACCATAGTAA pLKO_005 1137 CDS 100% 5.625 7.875 N RARS1 n/a
3 TRCN0000045428 CGAGCATATCAGTGTGTAGTT pLKO.1 893 CDS 100% 4.950 6.930 N RARS1 n/a
4 TRCN0000315734 CGAGCATATCAGTGTGTAGTT pLKO_005 893 CDS 100% 4.950 6.930 N RARS1 n/a
5 TRCN0000045430 CCACACTCTCTGTGATTATAT pLKO.1 1810 CDS 100% 15.000 10.500 N RARS1 n/a
6 TRCN0000315735 CCACACTCTCTGTGATTATAT pLKO_005 1810 CDS 100% 15.000 10.500 N RARS1 n/a
7 TRCN0000045431 CCTCCCAGACAATGAATGTAT pLKO.1 460 CDS 100% 5.625 3.938 N RARS1 n/a
8 TRCN0000315736 CCTCCCAGACAATGAATGTAT pLKO_005 460 CDS 100% 5.625 3.938 N RARS1 n/a
9 TRCN0000045432 CCTTCACTAGAATCAGGTCTA pLKO.1 1638 CDS 100% 4.050 2.835 N RARS1 n/a
10 TRCN0000315666 CCTTCACTAGAATCAGGTCTA pLKO_005 1638 CDS 100% 4.050 2.835 N RARS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002887.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06843 pDONR223 100% 99.9% 100% None 1497G>A n/a
2 ccsbBroad304_06843 pLX_304 0% 99.9% 100% V5 1497G>A n/a
3 TRCN0000472412 CCCCCGGATATCTCCACGCACGCG pLX_317 21.2% 99.9% 100% V5 1497G>A n/a
Download CSV