Transcript: Human NM_002956.2

Homo sapiens CAP-Gly domain containing linker protein 1 (CLIP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
CLIP1 (6249)
Length:
5898
CDS:
156..4439

Additional Resources:

NCBI RefSeq record:
NM_002956.2
NBCI Gene record:
CLIP1 (6249)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002956.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296065 CTAGATTACCAACACGAAATA pLKO_005 2124 CDS 100% 13.200 18.480 N CLIP1 n/a
2 TRCN0000116115 CGAAGGTAAATCGGAAATGAA pLKO.1 2474 CDS 100% 5.625 7.875 N CLIP1 n/a
3 TRCN0000116112 CCCGTCAACAAATCTAGGAAA pLKO.1 4548 3UTR 100% 4.950 6.930 N CLIP1 n/a
4 TRCN0000116116 CGGGTTGAAGAAGAATCAATT pLKO.1 1485 CDS 100% 13.200 10.560 N CLIP1 n/a
5 TRCN0000306993 CGGGTTGAAGAAGAATCAATT pLKO_005 1485 CDS 100% 13.200 10.560 N CLIP1 n/a
6 TRCN0000296125 GAACCTTTAAAGGGCATATTT pLKO_005 489 CDS 100% 15.000 10.500 N CLIP1 n/a
7 TRCN0000310185 ACTGGAGCATGCCCGCATTAA pLKO_005 1535 CDS 100% 13.200 9.240 N CLIP1 n/a
8 TRCN0000116113 CCGGGAAGAAACTCATCAGAA pLKO.1 1859 CDS 100% 4.950 3.465 N CLIP1 n/a
9 TRCN0000116114 CCTTCAAACATCCCTCAGAAA pLKO.1 645 CDS 100% 4.950 3.465 N CLIP1 n/a
10 TRCN0000296124 TACCCTCACAATACCTTATTT pLKO_005 4740 3UTR 100% 0.000 0.000 N CLIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002956.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15583 pDONR223 0% 24.1% 23.6% None (many diffs) n/a
2 ccsbBroad304_15583 pLX_304 0% 24.1% 23.6% V5 (many diffs) n/a
3 TRCN0000481010 CAGCTCACTCGGGGTAGTTAGGTT pLX_317 42.5% 24.1% 23.6% V5 (many diffs) n/a
Download CSV