Transcript: Human NM_002959.7

Homo sapiens sortilin 1 (SORT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SORT1 (6272)
Length:
6990
CDS:
27..2522

Additional Resources:

NCBI RefSeq record:
NM_002959.7
NBCI Gene record:
SORT1 (6272)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002959.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034496 CCGTCCTATCAATGTGATTAA pLKO.1 1649 CDS 100% 13.200 18.480 N Sort1 n/a
2 TRCN0000301697 CCGTCCTATCAATGTGATTAA pLKO_005 1649 CDS 100% 13.200 18.480 N Sort1 n/a
3 TRCN0000014370 GCCGTCCTATCAATGTGATTA pLKO.1 1648 CDS 100% 13.200 18.480 N SORT1 n/a
4 TRCN0000350547 GCCGTCCTATCAATGTGATTA pLKO_005 1648 CDS 100% 13.200 18.480 N SORT1 n/a
5 TRCN0000014372 ACACCTTTATTCGGACTGAAT pLKO.1 514 CDS 100% 4.950 6.930 N SORT1 n/a
6 TRCN0000315455 ACACCTTTATTCGGACTGAAT pLKO_005 514 CDS 100% 4.950 6.930 N SORT1 n/a
7 TRCN0000014368 GCTCCAACTTCAGGAAATAAA pLKO.1 2586 3UTR 100% 15.000 10.500 N SORT1 n/a
8 TRCN0000315427 GCTCCAACTTCAGGAAATAAA pLKO_005 2586 3UTR 100% 15.000 10.500 N SORT1 n/a
9 TRCN0000014371 GTGCTCATTGTGAAGAAATAT pLKO.1 2349 CDS 100% 15.000 10.500 N SORT1 n/a
10 TRCN0000315457 TCCATGTACCACTGGTAATTA pLKO_005 415 CDS 100% 15.000 10.500 N SORT1 n/a
11 TRCN0000350548 TATATCGAAGTGAGGATTATG pLKO_005 457 CDS 100% 13.200 9.240 N SORT1 n/a
12 TRCN0000014369 GCATTGTCTATTCCAAGTCTT pLKO.1 1174 CDS 100% 4.950 3.465 N SORT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002959.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489425 CTGATGTACAGCTGTTCTTTAACA pLX_317 15.2% 99.9% 100% V5 (not translated due to prior stop codon) 594T>C;969A>C n/a
2 TRCN0000491874 ACCCATCGGATGTATAGAGGGTCC pLX_317 13% 99.8% 99.8% V5 594T>C;969A>C;2493_2494insG n/a
Download CSV