Transcript: Human NM_003058.4

Homo sapiens solute carrier family 22 member 2 (SLC22A2), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SLC22A2 (6582)
Length:
2409
CDS:
65..1732

Additional Resources:

NCBI RefSeq record:
NM_003058.4
NBCI Gene record:
SLC22A2 (6582)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003058.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424216 GAATTTGTTGGGCGGAGATAT pLKO_005 743 CDS 100% 13.200 18.480 N SLC22A2 n/a
2 TRCN0000043244 CCCAACCTATACGTGGATGTT pLKO.1 655 CDS 100% 4.950 6.930 N SLC22A2 n/a
3 TRCN0000423519 CTCCTGGATGTTGGACCTATT pLKO_005 499 CDS 100% 10.800 7.560 N SLC22A2 n/a
4 TRCN0000043243 CCCACATTCATTAGGAATCTT pLKO.1 1439 CDS 100% 5.625 3.938 N SLC22A2 n/a
5 TRCN0000043246 CCAAGTTCAGAAACTAGACAT pLKO.1 1699 CDS 100% 4.950 3.465 N SLC22A2 n/a
6 TRCN0000043247 GCAAGAAATTGAACCCTTCAT pLKO.1 1047 CDS 100% 4.950 3.465 N SLC22A2 n/a
7 TRCN0000043245 CCTCCTAACTACAGTCCTCAT pLKO.1 601 CDS 100% 4.050 2.835 N SLC22A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003058.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11142 pDONR223 100% 42.3% 39.2% None (many diffs) n/a
2 ccsbBroad304_11142 pLX_304 0% 42.3% 39.2% V5 (many diffs) n/a
3 TRCN0000471840 CCTATACTTTAACCATTGAGGGAA pLX_317 58.8% 42.3% 39.2% V5 (many diffs) n/a
Download CSV