Transcript: Human NM_003088.4

Homo sapiens fascin actin-bundling protein 1 (FSCN1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FSCN1 (6624)
Length:
2784
CDS:
122..1603

Additional Resources:

NCBI RefSeq record:
NM_003088.4
NBCI Gene record:
FSCN1 (6624)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003088.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123040 CGACTATAACAAGGTGGCCAT pLKO.1 1489 CDS 100% 2.160 3.024 N FSCN1 n/a
2 TRCN0000289052 CGACTATAACAAGGTGGCCAT pLKO_005 1489 CDS 100% 2.160 3.024 N FSCN1 n/a
3 TRCN0000123043 CGGCCTCATCAACTGCGGCAA pLKO.1 163 CDS 100% 0.000 0.000 N FSCN1 n/a
4 TRCN0000123042 CAAGTTTGTGACCTCCAAGAA pLKO.1 1177 CDS 100% 4.950 3.465 N FSCN1 n/a
5 TRCN0000289000 CAAGTTTGTGACCTCCAAGAA pLKO_005 1177 CDS 100% 4.950 3.465 N FSCN1 n/a
6 TRCN0000123039 CCCTTGCCTTTCAAACTGGAA pLKO.1 1706 3UTR 100% 2.640 1.848 N FSCN1 n/a
7 TRCN0000289001 CCCTTGCCTTTCAAACTGGAA pLKO_005 1706 3UTR 100% 2.640 1.848 N FSCN1 n/a
8 TRCN0000123041 GCTGCTACTTTGACATCGAGT pLKO.1 1119 CDS 100% 2.640 1.848 N FSCN1 n/a
9 TRCN0000289051 GCTGCTACTTTGACATCGAGT pLKO_005 1119 CDS 100% 2.640 1.848 N FSCN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003088.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01565 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01565 pLX_304 0% 100% 100% V5 n/a
Download CSV