Transcript: Human NM_003089.6

Homo sapiens small nuclear ribonucleoprotein U1 subunit 70 (SNRNP70), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
SNRNP70 (6625)
Length:
1671
CDS:
197..1510

Additional Resources:

NCBI RefSeq record:
NM_003089.6
NBCI Gene record:
SNRNP70 (6625)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003089.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284831 TTCGTGGCGAGAGTGAATTAT pLKO_005 512 CDS 100% 15.000 21.000 N SNRNP70 n/a
2 TRCN0000000013 GCGCCGTACATTCGAGAGTTT pLKO.1 320 CDS 100% 4.950 6.930 N SNRNP70 n/a
3 TRCN0000000012 TCCGCTTACAAACACGCAGAT pLKO.1 671 CDS 100% 4.050 5.670 N SNRNP70 n/a
4 TRCN0000272733 TCCGCTTACAAACACGCAGAT pLKO_005 671 CDS 100% 4.050 5.670 N SNRNP70 n/a
5 TRCN0000272734 ACACCACAATCAACCTTATTG pLKO_005 292 CDS 100% 13.200 9.240 N SNRNP70 n/a
6 TRCN0000000011 CCAAGGGTAGGTGTCTCATTT pLKO.1 1607 3UTR 100% 13.200 9.240 N SNRNP70 n/a
7 TRCN0000272735 CCAAGGGTAGGTGTCTCATTT pLKO_005 1607 3UTR 100% 13.200 9.240 N SNRNP70 n/a
8 TRCN0000000015 GACATGCACTCCGCTTACAAA pLKO.1 662 CDS 100% 5.625 3.938 N SNRNP70 n/a
9 TRCN0000349622 GACATGCACTCCGCTTACAAA pLKO_005 662 CDS 100% 5.625 3.938 N SNRNP70 n/a
10 TRCN0000000014 CCGGAGAGAGTTTGAGGTGTA pLKO.1 553 CDS 100% 4.050 2.835 N SNRNP70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003089.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06982 pDONR223 100% 99.9% 100% None 933C>T n/a
2 ccsbBroad304_06982 pLX_304 0% 99.9% 100% V5 933C>T n/a
3 TRCN0000480471 CTCGCGGACACAGTTATGTTCTCA pLX_317 27.3% 99.9% 100% V5 933C>T n/a
Download CSV