Transcript: Human NM_003122.4

Homo sapiens serine peptidase inhibitor, Kazal type 1 (SPINK1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
SPINK1 (6690)
Length:
623
CDS:
290..529

Additional Resources:

NCBI RefSeq record:
NM_003122.4
NBCI Gene record:
SPINK1 (6690)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003122.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061779 CCAATGAATGCGTGTTATGTT pLKO.1 453 CDS 100% 5.625 7.875 N SPINK1 n/a
2 TRCN0000061780 CCCTGTTGAGTCTATCTGGTA pLKO.1 327 CDS 100% 2.640 3.696 N SPINK1 n/a
3 TRCN0000373562 TAATGGATGCACCAAGATATA pLKO_005 397 CDS 100% 13.200 9.240 N SPINK1 n/a
4 TRCN0000373561 CTGGGAAGAGAGGCCAAATGT pLKO_005 365 CDS 100% 5.625 3.938 N SPINK1 n/a
5 TRCN0000061781 GTGGGACTGATGGAAATACTT pLKO.1 429 CDS 100% 5.625 3.938 N SPINK1 n/a
6 TRCN0000061778 GCCAAATGTTACAATGAACTT pLKO.1 377 CDS 100% 4.950 3.465 N SPINK1 n/a
7 TRCN0000373633 CAAGATATATGACCCTGTCTG pLKO_005 409 CDS 100% 4.050 2.835 N SPINK1 n/a
8 TRCN0000061782 TGATGGAAATACTTATCCCAA pLKO.1 436 CDS 100% 2.640 1.848 N SPINK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003122.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01586 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01586 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474471 CGGCTATATCGGAATACAATCAAA pLX_317 100% 100% 100% V5 n/a
Download CSV