Transcript: Human NM_003202.5

Homo sapiens transcription factor 7 (TCF7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TCF7 (6932)
Length:
3288
CDS:
227..1381

Additional Resources:

NCBI RefSeq record:
NM_003202.5
NBCI Gene record:
TCF7 (6932)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003202.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021675 CCTTCCGATGACAGTGCTCTA pLKO.1 1360 CDS 100% 4.050 5.670 N TCF7 n/a
2 TRCN0000281257 CCTTCCGATGACAGTGCTCTA pLKO_005 1360 CDS 100% 4.050 5.670 N TCF7 n/a
3 TRCN0000021677 GCTCAAGTCGTCGCTCGTGAA pLKO.1 376 CDS 100% 1.350 1.890 N TCF7 n/a
4 TRCN0000021678 GCGGGACAACTACGGGAAGAA pLKO.1 1240 CDS 100% 1.650 1.320 N TCF7 n/a
5 TRCN0000281339 GCGGGACAACTACGGGAAGAA pLKO_005 1240 CDS 100% 1.650 1.320 N TCF7 n/a
6 TRCN0000262741 AGAAATGCATTCGGTACTTAC pLKO_005 1310 CDS 100% 10.800 7.560 N Tcf7 n/a
7 TRCN0000021674 CAACTCTCTCTCTACGAACAT pLKO.1 701 CDS 100% 4.950 3.465 N TCF7 n/a
8 TRCN0000281336 CAACTCTCTCTCTACGAACAT pLKO_005 701 CDS 100% 4.950 3.465 N TCF7 n/a
9 TRCN0000262740 GTTCACCCACCCATCCTTGAT pLKO_005 862 CDS 100% 4.950 3.465 N Tcf7 n/a
10 TRCN0000021676 CCATCCTTGATGCTAGGTTCT pLKO.1 872 CDS 100% 4.050 2.835 N TCF7 n/a
11 TRCN0000281338 CCATCCTTGATGCTAGGTTCT pLKO_005 872 CDS 100% 4.050 2.835 N TCF7 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2791 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2792 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2866 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003202.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487688 TTTGAATATCGGGTTTTTTCCAAT pLX_317 21.9% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV