Transcript: Human NM_003243.5

Homo sapiens transforming growth factor beta receptor 3 (TGFBR3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TGFBR3 (7049)
Length:
6339
CDS:
388..2943

Additional Resources:

NCBI RefSeq record:
NM_003243.5
NBCI Gene record:
TGFBR3 (7049)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145124 GTTGTATGCTGGGAATGACA pXPR_003 GGG 1283 50% 9 0.5935 TGFBR3 TGFBR3 76290
2 BRDN0001144841 CCATCAAGGGCTGACCACCG pXPR_003 GGG 1530 60% 10 0.3294 TGFBR3 TGFBR3 76292
3 BRDN0001146153 GATGACATTCCTTCAACCCA pXPR_003 AGG 968 38% 8 -0.0779 TGFBR3 TGFBR3 76291
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003243.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033429 CGACCTGAAATCGTGGTGTTT pLKO.1 2077 CDS 100% 4.950 6.930 N TGFBR3 n/a
2 TRCN0000359081 GGAGTTGGTAAAGGGTTAATA pLKO_005 3317 3UTR 100% 15.000 12.000 N TGFBR3 n/a
3 TRCN0000359000 TAATGGATTTCCGGGAGATAT pLKO_005 2028 CDS 100% 13.200 10.560 N TGFBR3 n/a
4 TRCN0000359001 CACACCCAGGGCTAGTATAAA pLKO_005 3113 3UTR 100% 15.000 10.500 N TGFBR3 n/a
5 TRCN0000033432 CGTGCTTTATCTCTCCATATT pLKO.1 2300 CDS 100% 13.200 9.240 N TGFBR3 n/a
6 TRCN0000033430 CCAAGCATGAAGGAACCAAAT pLKO.1 2683 CDS 100% 10.800 7.560 N TGFBR3 n/a
7 TRCN0000033433 GCCAGAGAATGGACACGTTTA pLKO.1 2226 CDS 100% 10.800 7.560 N TGFBR3 n/a
8 TRCN0000033431 CGAACTCAAGATAGCAAGAAA pLKO.1 912 CDS 100% 5.625 3.938 N TGFBR3 n/a
9 TRCN0000031005 CCTTCTCAAGAGGATCTTGAA pLKO.1 1159 CDS 100% 0.495 0.347 N Cflar n/a
10 TRCN0000301284 CCTTCTCAAGAGGATCTTGAA pLKO_005 1159 CDS 100% 0.495 0.347 N Cflar n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003243.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14863 pDONR223 62.2% 99.2% 28% None (many diffs) n/a
2 ccsbBroad304_14863 pLX_304 0% 99.2% 28% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000480390 GAGTTTGCGAAGGGGGGGTGCGCG pLX_317 15.6% 99.2% 28% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV