Transcript: Human NM_003284.4

Homo sapiens transition protein 1 (TNP1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TNP1 (7141)
Length:
407
CDS:
31..198

Additional Resources:

NCBI RefSeq record:
NM_003284.4
NBCI Gene record:
TNP1 (7141)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003284.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073284 CGATGACGCCAATCGCAATTA pLKO.1 162 CDS 100% 13.200 18.480 N TNP1 n/a
2 TRCN0000073283 GCCTATGGAATGTGGATCAAA pLKO.1 309 3UTR 100% 5.625 7.875 N TNP1 n/a
3 TRCN0000073286 CAAGAGCCGATCTCCTCACAA pLKO.1 75 CDS 100% 4.950 6.930 N TNP1 n/a
4 TRCN0000420763 ATACCGTAAGGGCAACCTGAA pLKO_005 126 CDS 100% 4.050 5.670 N TNP1 n/a
5 TRCN0000073287 TCGCAATTACCGCTCCCACTT pLKO.1 174 CDS 100% 4.050 5.670 N TNP1 n/a
6 TRCN0000073285 TCATGGCATGAGGAGGAGCAA pLKO.1 57 CDS 100% 2.640 1.848 N TNP1 n/a
7 TRCN0000427816 TGCGCTTCACACAGCACCAAG pLKO_005 222 3UTR 100% 1.350 0.945 N TNP1 n/a
8 TRCN0000441805 GTCAAGAGAGGTGGCAGCAAA pLKO_005 100 CDS 100% 4.950 2.970 N TNP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003284.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01695 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01695 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491558 TGCAATAGGCCTATGCTGTGCTTG pLX_317 100% 100% 100% V5 n/a
Download CSV