Transcript: Human NM_003292.3

Homo sapiens translocated promoter region, nuclear basket protein (TPR), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TPR (7175)
Length:
9636
CDS:
226..7317

Additional Resources:

NCBI RefSeq record:
NM_003292.3
NBCI Gene record:
TPR (7175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003292.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382108 AGCGTGATATGTACCGTATTT pLKO_005 2054 CDS 100% 13.200 18.480 N TPR n/a
2 TRCN0000060067 CGTAGGTACAAGACTCAATAT pLKO.1 4540 CDS 100% 13.200 18.480 N TPR n/a
3 TRCN0000300610 CGTAGGTACAAGACTCAATAT pLKO_005 4540 CDS 100% 13.200 18.480 N TPR n/a
4 TRCN0000304030 TGTTGACTATTATGCTCAAAG pLKO_005 7674 3UTR 100% 10.800 15.120 N TPR n/a
5 TRCN0000060064 CCAGGGAGATTATACACCTAT pLKO.1 5922 CDS 100% 4.950 6.930 N TPR n/a
6 TRCN0000060066 GCGATCTGAAACAGAAACCAA pLKO.1 2706 CDS 100% 3.000 4.200 N TPR n/a
7 TRCN0000300608 GCGATCTGAAACAGAAACCAA pLKO_005 2706 CDS 100% 3.000 4.200 N TPR n/a
8 TRCN0000340970 GAGTTACCCAGGGAGATTATA pLKO_005 5915 CDS 100% 15.000 10.500 N Tpr n/a
9 TRCN0000060065 CGCTGATGACTCAGAAGCAAA pLKO.1 1101 CDS 100% 4.950 3.465 N TPR n/a
10 TRCN0000300609 CGCTGATGACTCAGAAGCAAA pLKO_005 1101 CDS 100% 4.950 3.465 N TPR n/a
11 TRCN0000060063 GCCTTCTATCTCTCAACCTAT pLKO.1 5493 CDS 100% 4.950 3.465 N TPR n/a
12 TRCN0000300674 GCCTTCTATCTCTCAACCTAT pLKO_005 5493 CDS 100% 4.950 3.465 N TPR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003292.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14866 pDONR223 21.3% 96.2% 10.4% None (many diffs) n/a
2 ccsbBroad304_14866 pLX_304 0% 96.2% 10.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469003 GGCCATTTCGCTCCCTAATCACCC pLX_317 4.8% 95.9% 10.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV