Transcript: Human NM_003310.4

Homo sapiens EARP complex and GARP complex interacting protein 1 (EIPR1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
EIPR1 (7260)
Length:
1702
CDS:
130..1293

Additional Resources:

NCBI RefSeq record:
NM_003310.4
NBCI Gene record:
EIPR1 (7260)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003310.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038054 GCGGGTGAAATCTGGCATATT pLKO.1 319 CDS 100% 13.200 18.480 N EIPR1 n/a
2 TRCN0000038057 CCTTGACTTTAATCCCAATAA pLKO.1 828 CDS 100% 13.200 9.240 N EIPR1 n/a
3 TRCN0000299104 CCTTGACTTTAATCCCAATAA pLKO_005 828 CDS 100% 13.200 9.240 N EIPR1 n/a
4 TRCN0000038055 CGCAGTCTCTTAAATATGATA pLKO.1 230 CDS 100% 5.625 3.938 N EIPR1 n/a
5 TRCN0000299036 CGCAGTCTCTTAAATATGATA pLKO_005 230 CDS 100% 5.625 3.938 N EIPR1 n/a
6 TRCN0000038058 CCAGATCTACTGCATAGAGAA pLKO.1 783 CDS 100% 4.950 3.465 N EIPR1 n/a
7 TRCN0000299034 CCAGATCTACTGCATAGAGAA pLKO_005 783 CDS 100% 4.950 3.465 N EIPR1 n/a
8 TRCN0000038056 CCTTTCCAACATGGTGTCCAT pLKO.1 1023 CDS 100% 2.640 1.848 N EIPR1 n/a
9 TRCN0000299033 CCTTTCCAACATGGTGTCCAT pLKO_005 1023 CDS 100% 2.640 1.848 N EIPR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003310.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01719 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01719 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474729 TTAAACCGACAGCACAGGCCAGCC pLX_317 43.5% 100% 100% V5 n/a
Download CSV