Construct: ORF TRCN0000474729
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009474.1_s317c1
- Derived from:
- ccsbBroadEn_01719
- DNA Barcode:
- TTAAACCGACAGCACAGGCCAGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- EIPR1 (7260)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474729
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7260 | EIPR1 | EARP complex and GARP compl... | NM_003310.4 | 100% | 100% | |
| 2 | human | 7260 | EIPR1 | EARP complex and GARP compl... | XM_011510385.2 | 95.6% | 93% | (many diffs) |
| 3 | human | 7260 | EIPR1 | EARP complex and GARP compl... | NM_001330530.2 | 93.4% | 93.4% | 260_340del |
| 4 | human | 7260 | EIPR1 | EARP complex and GARP compl... | XM_011510383.3 | 89.6% | 87.2% | (many diffs) |
| 5 | human | 7260 | EIPR1 | EARP complex and GARP compl... | XM_006711893.2 | 74.1% | 74.1% | 0_1ins300 |
| 6 | human | 7260 | EIPR1 | EARP complex and GARP compl... | XM_017004818.2 | 74.1% | 74.1% | 0_1ins300 |
| 7 | human | 7260 | EIPR1 | EARP complex and GARP compl... | NM_001330531.2 | 62.7% | 62.7% | 0_1ins432 |
| 8 | mouse | 380752 | Tssc1 | tumor suppressing subtransf... | NM_201357.2 | 87% | 93% | (many diffs) |
| 9 | mouse | 380752 | Tssc1 | tumor suppressing subtransf... | XM_006515120.3 | 84.1% | 90% | (many diffs) |
| 10 | mouse | 380752 | Tssc1 | tumor suppressing subtransf... | XM_006515121.3 | 66.7% | 68% | (many diffs) |
| 11 | mouse | 380752 | Tssc1 | tumor suppressing subtransf... | XM_006515122.1 | 64.1% | 68.9% | (many diffs) |
| 12 | mouse | 380752 | Tssc1 | tumor suppressing subtransf... | XM_011243879.2 | 62.1% | 66.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1227
- ORF length:
- 1161
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggacgatgca ccagtgatct acgggctgga gttccaggca cgtgccttaa 121 cacctcaaac tgcagaaaca gatgccattc ggtttttggt tgggacgcag tctcttaaat 181 atgataatca gatccatatc atagattttg acgatgaaaa caacattata aataaaaatg 241 tcctcctcca tcaagcgggt gaaatctggc atattagcgc tagccctgca gacagaggtg 301 tgctgacgac ctgctacaac agaacttcag acagcaaagt cctgacatgt gcagccgtgt 361 ggaggatgcc gaaggaattg gaatcaggca gccacgagtc ccctgatgat tcatccagca 421 ctgcacagac cctggagctg ctctgtcacc ttgacaacac agcccatggc aacatggcct 481 gtgtcgtgtg ggagccaatg ggagatggga agaaaatcat ttccttggct gataaccata 541 tcctgctgtg ggatttacag gaaagctcga gccaggctgt gctggccagc tcagcgtccc 601 tggaagggaa gggacaactg aagttcacct caggacggtg gagcccacat cataactgca 661 cccaggtggc cacagcgaac gacaccaccc tccgtggctg ggacacccgg agcatgagcc 721 agaTCTACTG CATAGAGAAT GCCCACGGAC AGCTGGTGCG GGACCTTGAC TTTAATCCCA 781 ATAAGCAGTA CTACTTGGCC AGCTGCGGAG ACGACTGTAA GGTGAAGTTC TGGGACACCC 841 GAAATGTCAC CGAACCCGTG AAGACCCTGG AGGAGCACTC CCACTGGGTG TGGAACGTCC 901 GCTACAACCA CTCTCATGAC CAGCTGGTCC TCACGGGCAG CAGTGACAGC AGAGTCATCC 961 TTTCCAACAT GGTGTCCATC TCGTCGGAGC CCTTCGGCCA CTTGGTAGAC GACGATGACA 1021 TCAGTGACCA GGAGGACCAC CGTTCTGAAG AGAAGAGCAA GGAGCCCCTG CAGGACAACG 1081 TGATCGCCAC CTACGAGGAG CACGAGGACA GCGTCTATGC CGTGGACTGG TCCTCGGCTG 1141 ACCCGTGGCT GTTTGCCTCC CTGAGCTATG ACGGGAGGCT CGTGATCAAC AGGGTGCCCA 1201 GGGCCCTGAA GTACCACATC CTGCTATGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1261 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1321 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATTAAACCG 1381 ACAGCACAGG CCAGCCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1441 aagatt