Transcript: Human NM_003314.3

Homo sapiens tetratricopeptide repeat domain 1 (TTC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TTC1 (7265)
Length:
1441
CDS:
85..963

Additional Resources:

NCBI RefSeq record:
NM_003314.3
NBCI Gene record:
TTC1 (7265)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003314.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250121 CAGCTATATCAGGGCAATATT pLKO_005 642 CDS 100% 15.000 21.000 N TTC1 n/a
2 TRCN0000250122 CTGATGTAATGAACCTAATTT pLKO_005 1139 3UTR 100% 15.000 21.000 N TTC1 n/a
3 TRCN0000180065 CGGCTCGTACTCCATCAATTT pLKO.1 915 CDS 100% 13.200 18.480 N TTC1 n/a
4 TRCN0000250124 TATAGTCGAGCCCTCGAAATG pLKO_005 499 CDS 100% 10.800 15.120 N TTC1 n/a
5 TRCN0000250123 AGAAGAGAGCACTAGACTAAA pLKO_005 423 CDS 100% 13.200 9.240 N TTC1 n/a
6 TRCN0000250125 CCGGCTCGTACTCCATCAATT pLKO_005 914 CDS 100% 13.200 9.240 N TTC1 n/a
7 TRCN0000183743 CCTGATGTAATGAACCTAATT pLKO.1 1138 3UTR 100% 13.200 9.240 N TTC1 n/a
8 TRCN0000180503 GAACTTGGTTCTCCGACCTTT pLKO.1 849 CDS 100% 4.950 3.465 N TTC1 n/a
9 TRCN0000115165 GTATGAGATTACCTAAGCAAA pLKO.1 770 CDS 100% 4.950 3.465 N Ttc1 n/a
10 TRCN0000325264 GTATGAGATTACCTAAGCAAA pLKO_005 770 CDS 100% 4.950 3.465 N Ttc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003314.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07105 pDONR223 100% 99.8% 99.6% None 301G>A n/a
2 ccsbBroad304_07105 pLX_304 0% 99.8% 99.6% V5 301G>A n/a
3 TRCN0000481043 ACCCAATAAGCACCCAAAGTAGCA pLX_317 59.3% 99.8% 99.6% V5 301G>A n/a
Download CSV