Transcript: Human NM_003321.5

Homo sapiens Tu translation elongation factor, mitochondrial (TUFM), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TUFM (7284)
Length:
2011
CDS:
80..1447

Additional Resources:

NCBI RefSeq record:
NM_003321.5
NBCI Gene record:
TUFM (7284)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003321.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160152 CAGCCAATGATCTTAGAGAAA pLKO.1 1322 CDS 100% 4.950 6.930 N TUFM n/a
2 TRCN0000280865 CAGCCAATGATCTTAGAGAAA pLKO_005 1322 CDS 100% 4.950 6.930 N TUFM n/a
3 TRCN0000160932 GAAGTACGAGGAGATTGACAA pLKO.1 358 CDS 100% 4.950 6.930 N TUFM n/a
4 TRCN0000216957 CTCACCGAGTTTGGCTATAAA pLKO.1 695 CDS 100% 15.000 10.500 N Tufm n/a
5 TRCN0000248735 CTCACCGAGTTTGGCTATAAA pLKO_005 695 CDS 100% 15.000 10.500 N Tufm n/a
6 TRCN0000164867 GCTCACCGAGTTTGGCTATAA pLKO.1 694 CDS 100% 13.200 9.240 N TUFM n/a
7 TRCN0000280863 GCTCACCGAGTTTGGCTATAA pLKO_005 694 CDS 100% 13.200 9.240 N TUFM n/a
8 TRCN0000165471 GAGGACCTGAAGTTCAACCTA pLKO.1 1292 CDS 100% 3.000 2.100 N TUFM n/a
9 TRCN0000280864 GAGGACCTGAAGTTCAACCTA pLKO_005 1292 CDS 100% 3.000 2.100 N TUFM n/a
10 TRCN0000166529 CCAGGTTTACATCCTCAGCAA pLKO.1 1150 CDS 100% 2.640 1.848 N TUFM n/a
11 TRCN0000165718 CATAGCAAGAACATCCGCACT pLKO.1 971 CDS 100% 2.160 1.512 N TUFM n/a
12 TRCN0000280936 CATAGCAAGAACATCCGCACT pLKO_005 971 CDS 100% 2.160 1.512 N TUFM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003321.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01726 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01726 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471914 ATCAGCGGTGTTGTCGCTGATTTA pLX_317 35.3% 100% 100% V5 n/a
Download CSV