Transcript: Human NM_003330.4

Homo sapiens thioredoxin reductase 1 (TXNRD1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
TXNRD1 (7296)
Length:
3847
CDS:
306..1961

Additional Resources:

NCBI RefSeq record:
NM_003330.4
NBCI Gene record:
TXNRD1 (7296)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003330.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046535 CCTGCAAGACTCTCGAAATTA pLKO.1 698 CDS 100% 15.000 10.500 N TXNRD1 n/a
2 TRCN0000046536 CACAGGATTAAGGCAACAAAT pLKO.1 873 CDS 100% 13.200 9.240 N TXNRD1 n/a
3 TRCN0000046534 CGTCAAGAGATAACAACAAAT pLKO.1 1702 CDS 100% 13.200 9.240 N TXNRD1 n/a
4 TRCN0000046533 GCTGGATTTCTTGCTGGTATT pLKO.1 1077 CDS 100% 10.800 7.560 N TXNRD1 n/a
5 TRCN0000046537 CTGTATTTACTCCTTTGGAAT pLKO.1 1579 CDS 100% 4.950 2.970 N TXNRD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003330.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475454 CACCAACTTGCCTTTAGTCCAAAG pLX_317 33.7% 90.3% 90.1% V5 (many diffs) n/a
2 ccsbBroadEn_07112 pDONR223 100% 90.3% 90% None (many diffs) n/a
3 ccsbBroad304_07112 pLX_304 0% 90.3% 90% V5 (many diffs) n/a
Download CSV