Transcript: Human NM_003391.3

Homo sapiens Wnt family member 2 (WNT2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
WNT2 (7472)
Length:
3856
CDS:
70..1152

Additional Resources:

NCBI RefSeq record:
NM_003391.3
NBCI Gene record:
WNT2 (7472)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003391.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373977 CCACAAATGGTCCCAATTAAG pLKO_005 1540 3UTR 100% 13.200 18.480 N WNT2 n/a
2 TRCN0000373899 TCGGGAATCTGCCTTTGTTTA pLKO_005 384 CDS 100% 13.200 10.560 N WNT2 n/a
3 TRCN0000033373 CCTGTAGCCAAGGAGAAGTAA pLKO.1 446 CDS 100% 5.625 3.938 N WNT2 n/a
4 TRCN0000033372 CCGCGCATTTGTGGATGCAAA pLKO.1 573 CDS 100% 4.950 3.465 N WNT2 n/a
5 TRCN0000033371 CCAGATGTGATGCGTGCCATT pLKO.1 244 CDS 100% 4.050 2.835 N WNT2 n/a
6 TRCN0000033369 GCTCATGTACTCTCAGGACAT pLKO.1 707 CDS 100% 4.050 2.835 N WNT2 n/a
7 TRCN0000033370 CACAGGTTTCACTGTGGCTAA pLKO.1 819 CDS 100% 0.405 0.284 N WNT2 n/a
8 TRCN0000373978 TTGACTATGGGATCAAATTTG pLKO_005 551 CDS 100% 13.200 7.920 N WNT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003391.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01778 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01778 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468916 GATTATTAGTCAGGACCTGATCGC pLX_317 33.2% 100% 100% V5 n/a
Download CSV