Transcript: Human NM_003614.2

Homo sapiens galanin receptor 3 (GALR3), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
GALR3 (8484)
Length:
1147
CDS:
26..1132

Additional Resources:

NCBI RefSeq record:
NM_003614.2
NBCI Gene record:
GALR3 (8484)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378638 CAGCACCACGGACCTGTTCAT pLKO_005 187 CDS 100% 1.650 2.310 N GALR3 n/a
2 TRCN0000014500 CCTCGTCTGCAAGGCCGTGCA pLKO.1 301 CDS 100% 0.000 0.000 N GALR3 n/a
3 TRCN0000014499 CCTGCCTCAACCCGCTCGTCT pLKO.1 876 CDS 100% 0.000 0.000 N GALR3 n/a
4 TRCN0000363146 GCCTGTGGTCTTTGCCCTAAT pLKO_005 85 CDS 100% 10.800 7.560 N GALR3 n/a
5 TRCN0000014498 CTGTGGTCTTTGCCCTAATCT pLKO.1 87 CDS 100% 5.625 3.938 N GALR3 n/a
6 TRCN0000358302 TAATCTTCCTGCTGGGCACAG pLKO_005 102 CDS 100% 2.250 1.575 N GALR3 n/a
7 TRCN0000014501 CGGTGGCTGACCTCTGCTTCA pLKO.1 219 CDS 100% 0.000 0.000 N GALR3 n/a
8 TRCN0000014502 GCCTGGCCTACGCCAACTCCT pLKO.1 858 CDS 100% 0.000 0.000 N GALR3 n/a
9 TRCN0000358297 TCATCCTGTGCTTCTGGTACG pLKO_005 786 CDS 100% 2.250 1.350 N GALR3 n/a
10 TRCN0000028695 CTACGCCAACTCCTGCCTCAA pLKO.1 865 CDS 100% 1.350 0.810 N Galr3 n/a
11 TRCN0000028688 CTCATCTACCTCACCATGTAT pLKO.1 326 CDS 100% 5.625 3.938 N Galr3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488581 CCTGCTTTCCACTTTTAGTTCTGG pLX_317 30% 81.4% 100% V5 (many diffs) n/a
2 TRCN0000487914 TAGTGAAAACACATTTGAACTACA pLX_317 24.5% 81.4% 100% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV