Transcript: Human NM_003663.3

Homo sapiens CGG triplet repeat binding protein 1 (CGGBP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
CGGBP1 (8545)
Length:
4506
CDS:
411..914

Additional Resources:

NCBI RefSeq record:
NM_003663.3
NBCI Gene record:
CGGBP1 (8545)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003663.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436762 AGCTACGGAGGGCATATCTTC pLKO_005 844 CDS 100% 4.950 6.930 N CGGBP1 n/a
2 TRCN0000125746 CCACCTCAAGTCAAAGACTCA pLKO.1 590 CDS 100% 2.640 3.696 N Cggbp1 n/a
3 TRCN0000138097 GCGCAAACAGAGAAAGTCAGT pLKO.1 696 CDS 100% 2.640 3.696 N CGGBP1 n/a
4 TRCN0000419495 ATTCCTTGTGAGATTACTTAA pLKO_005 1247 3UTR 100% 13.200 9.240 N CGGBP1 n/a
5 TRCN0000414577 CAAGATAAATGTGGAGTATTA pLKO_005 939 3UTR 100% 13.200 9.240 N CGGBP1 n/a
6 TRCN0000435180 GATTGTTGACTAGGAGGTTAC pLKO_005 906 CDS 100% 6.000 4.200 N CGGBP1 n/a
7 TRCN0000415322 GATATGAGAATGAGAATCAAC pLKO_005 871 CDS 100% 4.950 3.465 N CGGBP1 n/a
8 TRCN0000137538 CCCTAACTGCATCTCTTCAGT pLKO.1 664 CDS 100% 3.000 2.100 N CGGBP1 n/a
9 TRCN0000135069 CTTCTTGCAATGTGGTTCTGA pLKO.1 541 CDS 100% 3.000 2.100 N CGGBP1 n/a
10 TRCN0000137725 GCTGCATGAAGATGGAGGAAA pLKO.1 509 CDS 100% 4.950 2.970 N CGGBP1 n/a
11 TRCN0000125748 CATGTTCGCAAGTCTGCCATT pLKO.1 564 CDS 100% 4.050 2.430 N Cggbp1 n/a
12 TRCN0000138712 GAAACCGTTCTAAGACTGCCT pLKO.1 445 CDS 100% 0.660 0.924 N CGGBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003663.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01950 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01950 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466733 ATCGATACCGAATTCTCCGGACTG pLX_317 80.9% 100% 100% V5 n/a
Download CSV