Transcript: Human NM_003675.4

Homo sapiens pre-mRNA processing factor 18 (PRPF18), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PRPF18 (8559)
Length:
1670
CDS:
123..1151

Additional Resources:

NCBI RefSeq record:
NM_003675.4
NBCI Gene record:
PRPF18 (8559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003675.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010512 GACGAAACTCAGCGGAAATAT pLKO.1 1044 CDS 100% 15.000 12.000 N PRPF18 n/a
2 TRCN0000314724 GACGAAACTCAGCGGAAATAT pLKO_005 1044 CDS 100% 15.000 12.000 N PRPF18 n/a
3 TRCN0000000016 GATCTGTGTATGGTGTGTTAA pLKO.1 1152 CDS 100% 13.200 9.240 N PRPF18 n/a
4 TRCN0000314726 GATCTGTGTATGGTGTGTTAA pLKO_005 1152 CDS 100% 13.200 9.240 N PRPF18 n/a
5 TRCN0000000019 GAATACGTGAAGGCAAATGAT pLKO.1 903 CDS 100% 5.625 3.938 N PRPF18 n/a
6 TRCN0000000018 GACTATTTGGAGAGACTGATT pLKO.1 409 CDS 100% 4.950 3.465 N PRPF18 n/a
7 TRCN0000000017 GAGGAGAACCAATCAGACTAT pLKO.1 394 CDS 100% 4.950 3.465 N PRPF18 n/a
8 TRCN0000314723 GAGGAGAACCAATCAGACTAT pLKO_005 394 CDS 100% 4.950 3.465 N PRPF18 n/a
9 TRCN0000314652 GGAATCTTCCTGCTGATATTA pLKO_005 841 CDS 100% 15.000 9.000 N PRPF18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003675.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07263 pDONR223 100% 99.8% 99.7% None 8T>C;549A>G n/a
2 ccsbBroad304_07263 pLX_304 0% 99.8% 99.7% V5 8T>C;549A>G n/a
3 TRCN0000480692 TTCAGCATCACCTTTAACGAACCA pLX_317 42.2% 99.8% 99.7% V5 8T>C;549A>G n/a
Download CSV