Transcript: Human NM_003710.4

Homo sapiens serine peptidase inhibitor, Kunitz type 1 (SPINT1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
SPINT1 (6692)
Length:
2978
CDS:
205..1746

Additional Resources:

NCBI RefSeq record:
NM_003710.4
NBCI Gene record:
SPINT1 (6692)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003710.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073577 CTTTACCTATGGTGGTTGTTA pLKO.1 1410 CDS 100% 5.625 7.875 N SPINT1 n/a
2 TRCN0000073576 CGGGAAGAAGAGTGCATTCTA pLKO.1 1078 CDS 100% 5.625 3.938 N SPINT1 n/a
3 TRCN0000073573 CCTGTGTAGTTTGTGCTGTAA pLKO.1 2159 3UTR 100% 4.950 3.465 N SPINT1 n/a
4 TRCN0000073575 CTTCGGGAAGAAGAGTGCATT pLKO.1 1075 CDS 100% 4.950 3.465 N SPINT1 n/a
5 TRCN0000073574 GCTTTACCTATGGTGGTTGTT pLKO.1 1409 CDS 100% 4.950 3.465 N SPINT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003710.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06989 pDONR223 100% 99.8% 100% None 1227C>T;1530G>C n/a
2 ccsbBroad304_06989 pLX_304 0% 99.8% 100% V5 1227C>T;1530G>C n/a
3 TRCN0000465374 AAGCCATATTTCATAACCAGGTTG pLX_317 6.7% 99.8% 100% V5 1227C>T;1530G>C n/a
Download CSV