Transcript: Human NM_003711.4

Homo sapiens phospholipid phosphatase 1 (PLPP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PLPP1 (8611)
Length:
1542
CDS:
336..1190

Additional Resources:

NCBI RefSeq record:
NM_003711.4
NBCI Gene record:
PLPP1 (8611)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003711.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002580 GTCTTGTTGCCGTATCCATTT pLKO.1 949 CDS 100% 10.800 15.120 N PLPP1 n/a
2 TRCN0000277740 GTCTTGTTGCCGTATCCATTT pLKO_005 949 CDS 100% 10.800 15.120 N PLPP1 n/a
3 TRCN0000002579 CGGCCTCACTTCTTGGATGTT pLKO.1 714 CDS 100% 4.950 3.465 N PLPP1 n/a
4 TRCN0000277804 CGGCCTCACTTCTTGGATGTT pLKO_005 714 CDS 100% 4.950 3.465 N PLPP1 n/a
5 TRCN0000002578 CTCTGCATGAAACACCAACAA pLKO.1 1135 CDS 100% 4.950 3.465 N PLPP1 n/a
6 TRCN0000277768 CTCTGCATGAAACACCAACAA pLKO_005 1135 CDS 100% 4.950 3.465 N PLPP1 n/a
7 TRCN0000002577 GAGGGAATGCAGAAAGAGTTA pLKO.1 796 CDS 100% 4.950 3.465 N PLPP1 n/a
8 TRCN0000277802 GAGGGAATGCAGAAAGAGTTA pLKO_005 796 CDS 100% 4.950 3.465 N PLPP1 n/a
9 TRCN0000010720 CTGCTGCTATGCCTCTTGGAT pLKO.1 1302 3UTR 100% 3.000 2.100 N PLPP1 n/a
10 TRCN0000277803 CTGCTGCTATGCCTCTTGGAT pLKO_005 1302 3UTR 100% 3.000 2.100 N PLPP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003711.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01967 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01967 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470371 TCAACTTGTCATCGGTTGGGCCTC pLX_317 54% 100% 100% V5 n/a
Download CSV