Transcript: Human NM_003712.4

Homo sapiens phospholipid phosphatase 2 (PLPP2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PLPP2 (8612)
Length:
1279
CDS:
68..934

Additional Resources:

NCBI RefSeq record:
NM_003712.4
NBCI Gene record:
PLPP2 (8612)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003712.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002582 GCTCTATTCTCGCTCGGACTT pLKO.1 310 CDS 100% 4.050 5.670 N PLPP2 n/a
2 TRCN0000381716 CAACTACGTGGCTGCTGTATA pLKO_005 334 CDS 100% 13.200 10.560 N PLPP2 n/a
3 TRCN0000350421 TGTACACAGACCGGCTCTATT pLKO_005 297 CDS 100% 13.200 9.240 N PLPP2 n/a
4 TRCN0000379701 ACATCTCAGACTTCTTCAAAG pLKO_005 792 CDS 100% 10.800 7.560 N PLPP2 n/a
5 TRCN0000336161 ACCTGGCCAAGTACATGATTG pLKO_005 408 CDS 100% 10.800 7.560 N Plpp2 n/a
6 TRCN0000381061 ACCTGGCCAAGTACATGATTG pLKO_005 408 CDS 100% 10.800 7.560 N PLPP2 n/a
7 TRCN0000002584 GAAGGGACCGAGAGATCAGAT pLKO.1 1193 3UTR 100% 4.950 3.465 N PLPP2 n/a
8 TRCN0000315259 GAAGGGACCGAGAGATCAGAT pLKO_005 1193 3UTR 100% 4.950 3.465 N PLPP2 n/a
9 TRCN0000002583 GAGGCTGACCACAACCACTAT pLKO.1 890 CDS 100% 4.950 3.465 N PLPP2 n/a
10 TRCN0000315190 GAGGCTGACCACAACCACTAT pLKO_005 890 CDS 100% 4.950 3.465 N PLPP2 n/a
11 TRCN0000002585 CGGGTCAACTGCTCGGTCTAT pLKO.1 476 CDS 100% 1.650 1.155 N PLPP2 n/a
12 TRCN0000002581 CGCTATCCTGACGCTGGTGAA pLKO.1 133 CDS 100% 1.350 0.945 N PLPP2 n/a
13 TRCN0000315189 CGCTATCCTGACGCTGGTGAA pLKO_005 133 CDS 100% 1.350 0.945 N PLPP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003712.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01968 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01968 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473645 TCGAACAACATATAAACTGATGAT pLX_317 6.5% 99.8% 95.4% V5 (not translated due to prior stop codon) 824_825insG n/a
Download CSV