Transcript: Human NM_003757.3

Homo sapiens eukaryotic translation initiation factor 3 subunit I (EIF3I), mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
EIF3I (8668)
Length:
1937
CDS:
534..1511

Additional Resources:

NCBI RefSeq record:
NM_003757.3
NBCI Gene record:
EIF3I (8668)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003757.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074814 GCGGTCCATTACGCAGATTAA pLKO.1 563 CDS 100% 13.200 18.480 N EIF3I n/a
2 TRCN0000074817 CGAAGATGGTTACGTCCGTAT pLKO.1 1445 CDS 100% 4.050 5.670 N EIF3I n/a
3 TRCN0000307917 CGAAGATGGTTACGTCCGTAT pLKO_005 1445 CDS 100% 4.050 5.670 N EIF3I n/a
4 TRCN0000074816 CCATTACTTCGACCCACAGTA pLKO.1 1466 CDS 100% 4.950 3.465 N EIF3I n/a
5 TRCN0000291993 CCATTACTTCGACCCACAGTA pLKO_005 1466 CDS 100% 4.950 3.465 N EIF3I n/a
6 TRCN0000074815 CCCTATCGTCAATGTATGGTA pLKO.1 626 CDS 100% 3.000 2.100 N EIF3I n/a
7 TRCN0000292031 CCCTATCGTCAATGTATGGTA pLKO_005 626 CDS 100% 3.000 2.100 N EIF3I n/a
8 TRCN0000074813 GTGAGCTGAGATCACGTCATT pLKO.1 1748 3UTR 100% 4.950 2.475 Y EIF3I n/a
9 TRCN0000291994 GTGAGCTGAGATCACGTCATT pLKO_005 1748 3UTR 100% 4.950 2.475 Y EIF3I n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003757.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01986 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01986 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480882 CACTTCCCTCACCCACATTGCCAG pLX_317 48% 100% 100% V5 n/a
Download CSV