Transcript: Human NM_003808.3

Homo sapiens TNF superfamily member 13 (TNFSF13), transcript variant alpha, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
TNFSF13 (8741)
Length:
2293
CDS:
749..1501

Additional Resources:

NCBI RefSeq record:
NM_003808.3
NBCI Gene record:
TNFSF13 (8741)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003808.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358632 CAGTTGCCCTCTGGTTGAGTT pLKO_005 831 CDS 100% 4.950 6.930 N TNFSF13 n/a
2 TRCN0000358565 ATGGCTCTGCTGACCCAACAA pLKO_005 884 CDS 100% 4.950 3.465 N TNFSF13 n/a
3 TRCN0000358631 CCCAACAAACAGAGCTGCAGA pLKO_005 897 CDS 100% 2.640 1.848 N TNFSF13 n/a
4 TRCN0000358567 CAAAGGGCCTCCAGGCAACAT pLKO_005 781 CDS 100% 1.650 1.155 N TNFSF13 n/a
5 TRCN0000204769 GACAGCCAAGAGCTGAGTATA pLKO.1 1557 3UTR 100% 13.200 6.600 Y TNFSF12-TNFSF13 n/a
6 TRCN0000059023 GAGACTCTATTCCGATGTATA pLKO.1 1319 CDS 100% 13.200 6.600 Y TNFSF13 n/a
7 TRCN0000059026 CGCAGGTGTCTTCCATTTACA pLKO.1 1387 CDS 100% 5.625 2.813 Y TNFSF13 n/a
8 TRCN0000204329 CGCAGGTGTCTTCCATTTACA pLKO.1 1387 CDS 100% 5.625 2.813 Y TNFSF12-TNFSF13 n/a
9 TRCN0000059025 CCTGTTTCAAGACGTGACTTT pLKO.1 1255 CDS 100% 4.950 2.475 Y TNFSF13 n/a
10 TRCN0000186304 CTTCGCAGTCAAATTACTCTT pLKO.1 2054 3UTR 100% 4.950 2.475 Y TNFSF12-TNFSF13 n/a
11 TRCN0000188573 CCAAGGATATGGTGTCCGAAT pLKO.1 1198 CDS 100% 4.050 2.025 Y TNFSF12-TNFSF13 n/a
12 TRCN0000204239 CAAGGGCGAAACTTAACCTCT pLKO.1 1443 CDS 100% 2.640 1.320 Y TNFSF12-TNFSF13 n/a
13 TRCN0000059027 GCGAAACTTAACCTCTCTCCA pLKO.1 1448 CDS 100% 2.640 1.320 Y TNFSF13 n/a
14 TRCN0000059024 GAATCCAGGATGCTGGAGTTT pLKO.1 1215 CDS 100% 0.495 0.248 Y TNFSF13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003808.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07292 pDONR223 100% 98.4% 98% None 287A>G;738_739delGTinsAC;742_750delGTGAAACTG n/a
2 ccsbBroad304_07292 pLX_304 0% 98.4% 98% V5 287A>G;738_739delGTinsAC;742_750delGTGAAACTG n/a
3 TRCN0000491921 CGAGAAGCCCCTTATGACGTCTTC pLX_317 47.5% 98.4% 98% V5 287A>G;738_739delGTinsAC;742_750delGTGAAACTG n/a
Download CSV