Transcript: Human NM_003941.4

Homo sapiens WASP like actin nucleation promoting factor (WASL), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
WASL (8976)
Length:
4363
CDS:
270..1787

Additional Resources:

NCBI RefSeq record:
NM_003941.4
NBCI Gene record:
WASL (8976)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003941.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123059 CCTGTTATTGTGTGCAAGTTT pLKO.1 1986 3UTR 100% 5.625 3.938 N WASL n/a
2 TRCN0000307002 CCTGTTATTGTGTGCAAGTTT pLKO_005 1986 3UTR 100% 5.625 3.938 N WASL n/a
3 TRCN0000123062 CAGGAAACAAAGCAGCTCTTT pLKO.1 1477 CDS 100% 4.950 3.465 N WASL n/a
4 TRCN0000288996 CAGGAAACAAAGCAGCTCTTT pLKO_005 1477 CDS 100% 4.950 3.465 N WASL n/a
5 TRCN0000123060 CGGCAAGAAATGTGTGACTAT pLKO.1 371 CDS 100% 4.950 3.465 N WASL n/a
6 TRCN0000289046 CGGCAAGAAATGTGTGACTAT pLKO_005 371 CDS 100% 4.950 3.465 N WASL n/a
7 TRCN0000123061 GCACAACTTAAAGACAGAGAA pLKO.1 999 CDS 100% 4.950 3.465 N WASL n/a
8 TRCN0000289045 GCACAACTTAAAGACAGAGAA pLKO_005 999 CDS 100% 4.950 3.465 N WASL n/a
9 TRCN0000123063 GCTGGAGATACTTGTCAAGTT pLKO.1 600 CDS 100% 4.950 3.465 N WASL n/a
10 TRCN0000307001 GCTGGAGATACTTGTCAAGTT pLKO_005 600 CDS 100% 4.950 3.465 N WASL n/a
11 TRCN0000099643 AGATTAACCAAGGCAGATATT pLKO.1 858 CDS 100% 13.200 9.240 N Wasl n/a
12 TRCN0000099641 GCTGGAGATACTTGTCAAGTA pLKO.1 600 CDS 100% 4.950 3.465 N Wasl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003941.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467204 CCGGTGTTAACATGATCCTAAAGC pLX_317 25.4% 100% 100% V5 n/a
2 ccsbBroadEn_07334 pDONR223 100% 99.9% 100% None 1140A>C n/a
3 ccsbBroad304_07334 pLX_304 0% 99.9% 100% V5 1140A>C n/a
Download CSV