Transcript: Human NM_003945.4

Homo sapiens ATPase H+ transporting V0 subunit e1 (ATP6V0E1), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
ATP6V0E1 (8992)
Length:
1419
CDS:
91..336

Additional Resources:

NCBI RefSeq record:
NM_003945.4
NBCI Gene record:
ATP6V0E1 (8992)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003945.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038519 CGTGGGAATCAGTGAAGTGTT pLKO.1 681 3UTR 100% 4.950 3.960 N ATP6V0E1 n/a
2 TRCN0000038521 GTTCATCCCTAAGGGTCCTAA pLKO.1 168 CDS 100% 4.950 3.960 N ATP6V0E1 n/a
3 TRCN0000218669 ATTAGCTGCCTTAAACGTTAA pLKO_005 451 3UTR 100% 10.800 7.560 N ATP6V0E1 n/a
4 TRCN0000038520 CCCTCTCTTTGGACCGCAATT pLKO.1 273 CDS 100% 10.800 7.560 N ATP6V0E1 n/a
5 TRCN0000230073 CCCTCTCTTTGGACCGCAATT pLKO_005 273 CDS 100% 10.800 7.560 N ATP6V0E1 n/a
6 TRCN0000230072 TTCATCCCTAAGGGTCCTAAC pLKO_005 169 CDS 100% 6.000 4.200 N ATP6V0E1 n/a
7 TRCN0000038522 TCTGGTATCTGAAGTATCATT pLKO.1 308 CDS 100% 5.625 3.938 N ATP6V0E1 n/a
8 TRCN0000230074 TCTGGTATCTGAAGTATCATT pLKO_005 308 CDS 100% 5.625 3.938 N ATP6V0E1 n/a
9 TRCN0000380795 AGGAAGAAGACATGCTCTACA pLKO_005 336 CDS 100% 4.950 3.465 N ATP6V0E1 n/a
10 TRCN0000218687 TTCAGTTTGCTGCTATCTCTT pLKO_005 222 CDS 100% 4.950 3.465 N ATP6V0E1 n/a
11 TRCN0000307601 TTCAGTTTGCTGCTATCTCTT pLKO_005 222 CDS 100% 4.950 3.465 N Atp6v0e n/a
12 TRCN0000380286 TTGCAATTCTGGCCCAACTCA pLKO_005 251 CDS 100% 3.000 2.100 N ATP6V0E1 n/a
13 TRCN0000038523 CGGCTTCTTGGTGCCTTGGTT pLKO.1 150 CDS 100% 1.000 0.700 N ATP6V0E1 n/a
14 TRCN0000080804 TGAAACCATCTGGTATCTGAA pLKO.1 300 CDS 100% 4.950 2.970 N Atp6v0e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003945.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02061 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02061 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473095 CATCTCTTCATCAAACAACCATTC pLX_317 100% 100% 100% V5 n/a
Download CSV