Transcript: Human NM_003948.5

Homo sapiens cyclin dependent kinase like 2 (CDKL2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
CDKL2 (8999)
Length:
4704
CDS:
517..1998

Additional Resources:

NCBI RefSeq record:
NM_003948.5
NBCI Gene record:
CDKL2 (8999)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003948.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355562 GATGTGTTTAGGTAATCTAAT pLKO_005 1161 CDS 100% 13.200 18.480 N CDKL2 n/a
2 TRCN0000338224 GCGAGAAATCAAGTTACTAAA pLKO_005 663 CDS 100% 13.200 18.480 N CDKL2 n/a
3 TRCN0000350964 CGTTGTCAAGCTATGCGATTT pLKO_005 930 CDS 100% 10.800 15.120 N CDKL2 n/a
4 TRCN0000000728 TGCGAGAAATCAAGTTACTAA pLKO.1 662 CDS 100% 5.625 7.875 N CDKL2 n/a
5 TRCN0000000725 CAGTAGGACAAGCCACAACAA pLKO.1 1656 CDS 100% 4.950 6.930 N CDKL2 n/a
6 TRCN0000199431 CCATTGGTTGTCTGGTAACTG pLKO.1 1076 CDS 100% 4.950 6.930 N CDKL2 n/a
7 TRCN0000378478 GGGAGGTTTATACTGATTATG pLKO_005 980 CDS 100% 13.200 9.240 N CDKL2 n/a
8 TRCN0000338223 TCACGTCCACCGATGCTATTT pLKO_005 2228 3UTR 100% 13.200 9.240 N CDKL2 n/a
9 TRCN0000418915 TTACTGTTAGGAGATTGTATA pLKO_005 2304 3UTR 100% 13.200 9.240 N CDKL2 n/a
10 TRCN0000000727 CCATCAGGCATTTATAACATT pLKO.1 1897 CDS 100% 5.625 3.938 N CDKL2 n/a
11 TRCN0000000726 GAGTTATGGAATGGTGATGAA pLKO.1 555 CDS 100% 4.950 3.465 N CDKL2 n/a
12 TRCN0000338222 GAGTTATGGAATGGTGATGAA pLKO_005 555 CDS 100% 4.950 3.465 N CDKL2 n/a
13 TRCN0000000724 GAACTGGATGATGCTCTTGCA pLKO.1 2015 3UTR 100% 2.640 1.848 N CDKL2 n/a
14 TRCN0000195050 CTGATATTGATCAGCTATATC pLKO.1 1133 CDS 100% 1.320 0.924 N CDKL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003948.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475406 TTCCAGGTCAAGTCGTGACATCTG pLX_317 84.2% 33.1% 30.8% V5 (many diffs) n/a
Download CSV