Transcript: Human NM_004017.3

Homo sapiens dystrophin (DMD), transcript variant Dp71a, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
DMD (1756)
Length:
4637
CDS:
126..1940

Additional Resources:

NCBI RefSeq record:
NM_004017.3
NBCI Gene record:
DMD (1756)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004017.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413848 ACTATCCCATGGTGGAATATT pLKO_005 979 CDS 100% 15.000 21.000 N DMD n/a
2 TRCN0000428334 AGACTTTGCCAAGGTACTAAA pLKO_005 1031 CDS 100% 13.200 10.560 N DMD n/a
3 TRCN0000434226 AGCAGAATATGACCGTCTAAA pLKO_005 1445 CDS 100% 13.200 10.560 N DMD n/a
4 TRCN0000420010 TGTGAAGGGTAGTGGTATTAT pLKO_005 2124 3UTR 100% 15.000 10.500 N DMD n/a
5 TRCN0000053247 GCTGCTTCCAATTTGCTAATA pLKO.1 715 CDS 100% 13.200 9.240 N DMD n/a
6 TRCN0000053245 CCAGCATTACTGCCAAAGTTT pLKO.1 1298 CDS 100% 5.625 3.938 N DMD n/a
7 TRCN0000053244 GCCAAATGTAACATCTGCAAA pLKO.1 852 CDS 100% 4.950 3.465 N DMD n/a
8 TRCN0000053246 CCAGTCTTTAGCTGACCTGAA pLKO.1 197 CDS 100% 4.050 2.835 N DMD n/a
9 TRCN0000053243 CCCTAGTTCAAGAGGAAGAAA pLKO.1 1883 CDS 100% 5.625 3.375 N DMD n/a
10 TRCN0000178741 CACACACATACACACACACAA pLKO.1 2409 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004017.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06103 pDONR223 100% 94.3% 93.3% None (many diffs) n/a
2 ccsbBroad304_06103 pLX_304 0% 94.3% 93.3% V5 (many diffs) n/a
3 TRCN0000481202 TACATTCTGGCATTCTTTAAGCAA pLX_317 24.3% 94.3% 93.3% V5 (many diffs) n/a
Download CSV