Transcript: Human NM_004095.4

Homo sapiens eukaryotic translation initiation factor 4E binding protein 1 (EIF4EBP1), mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
EIF4EBP1 (1978)
Length:
827
CDS:
41..397

Additional Resources:

NCBI RefSeq record:
NM_004095.4
NBCI Gene record:
EIF4EBP1 (1978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004095.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040206 CGGTGAAGAGTCACAGTTTGA pLKO.1 364 CDS 100% 4.950 6.930 N EIF4EBP1 n/a
2 TRCN0000298904 CGGTGAAGAGTCACAGTTTGA pLKO_005 364 CDS 100% 4.950 6.930 N EIF4EBP1 n/a
3 TRCN0000040205 ACAGTTTGAGATGGACATTTA pLKO.1 376 CDS 100% 13.200 9.240 N EIF4EBP1 n/a
4 TRCN0000298903 ACAGTTTGAGATGGACATTTA pLKO_005 376 CDS 100% 13.200 9.240 N EIF4EBP1 n/a
5 TRCN0000040207 GCGCAATAGCCCAGAAGATAA pLKO.1 334 CDS 100% 13.200 9.240 N EIF4EBP1 n/a
6 TRCN0000298905 GCGCAATAGCCCAGAAGATAA pLKO_005 334 CDS 100% 13.200 9.240 N EIF4EBP1 n/a
7 TRCN0000040204 AGGATCATCTATGACCGGAAA pLKO.1 191 CDS 100% 4.050 2.835 N EIF4EBP1 n/a
8 TRCN0000040203 GCCAGGCCTTATGAAAGTGAT pLKO.1 465 3UTR 100% 4.950 2.970 N EIF4EBP1 n/a
9 TRCN0000310343 GCCAGGCCTTATGAAAGTGAT pLKO_005 465 3UTR 100% 4.950 2.970 N EIF4EBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004095.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00490 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00490 pLX_304 97.5% 100% 100% V5 n/a
3 TRCN0000468751 TGAACACGATACCGGTTTCGATCC pLX_317 100% 100% 100% V5 n/a
Download CSV