Transcript: Human NM_004128.3

Homo sapiens general transcription factor IIF subunit 2 (GTF2F2), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
GTF2F2 (2963)
Length:
2228
CDS:
147..896

Additional Resources:

NCBI RefSeq record:
NM_004128.3
NBCI Gene record:
GTF2F2 (2963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020890 CGAGCTGATAAACAACATGTT pLKO.1 675 CDS 100% 4.950 6.930 N GTF2F2 n/a
2 TRCN0000280282 CGAGCTGATAAACAACATGTT pLKO_005 675 CDS 100% 4.950 6.930 N GTF2F2 n/a
3 TRCN0000020889 GCTGAGGTAATACAGATCCAA pLKO.1 1243 3UTR 100% 3.000 4.200 N GTF2F2 n/a
4 TRCN0000280347 GCTGAGGTAATACAGATCCAA pLKO_005 1243 3UTR 100% 3.000 4.200 N GTF2F2 n/a
5 TRCN0000280283 TTGTCACAGCAATGGGCTAAA pLKO_005 225 CDS 100% 10.800 8.640 N GTF2F2 n/a
6 TRCN0000020892 GCTCCTAGAGAACATCCATTT pLKO.1 375 CDS 100% 10.800 7.560 N GTF2F2 n/a
7 TRCN0000280345 GCTCCTAGAGAACATCCATTT pLKO_005 375 CDS 100% 10.800 7.560 N GTF2F2 n/a
8 TRCN0000020891 GCTCATCAGATAAGCTGTCAT pLKO.1 442 CDS 100% 4.950 3.465 N GTF2F2 n/a
9 TRCN0000280280 GCTCATCAGATAAGCTGTCAT pLKO_005 442 CDS 100% 4.950 3.465 N GTF2F2 n/a
10 TRCN0000020893 GTGGCTAGTCAAGGTTCCTAA pLKO.1 200 CDS 100% 4.950 3.465 N GTF2F2 n/a
11 TRCN0000085662 AGCTGGACAAAGTTGTAACAA pLKO.1 577 CDS 100% 5.625 3.375 N Gtf2f2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06339 pDONR223 100% 99.7% 100% None 102C>T;621G>A n/a
Download CSV