Transcript: Human NM_004152.3

Homo sapiens ornithine decarboxylase antizyme 1 (OAZ1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
OAZ1 (4946)
Length:
1195
CDS:
114..801

Additional Resources:

NCBI RefSeq record:
NM_004152.3
NBCI Gene record:
OAZ1 (4946)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004152.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078494 CACTGCTGTAGTAACCCGGGT pLKO.1 276 CDS 100% 0.180 0.252 N OAZ1 n/a
2 TRCN0000298606 ATGTTGTAATCGTGCAAATAA pLKO_005 900 3UTR 100% 15.000 12.000 N OAZ1 n/a
3 TRCN0000293882 ACAATCTTTCAGCTAACTTAT pLKO_005 377 CDS 100% 13.200 9.240 N OAZ1 n/a
4 TRCN0000078497 CTCCCTCCACTGCTGTAGTAA pLKO.1 269 CDS 100% 5.625 3.938 N OAZ1 n/a
5 TRCN0000298228 CTCCCTCCACTGCTGTAGTAA pLKO_005 269 CDS 100% 5.625 3.938 N OAZ1 n/a
6 TRCN0000078493 GCGGTGTATTTCTTGAAGTTT pLKO.1 938 3UTR 100% 5.625 3.938 N OAZ1 n/a
7 TRCN0000078495 CCACTGCTTCGCCAGAGAGAA pLKO.1 149 CDS 100% 1.650 1.155 N OAZ1 n/a
8 TRCN0000286446 CCACTGCTTCGCCAGAGAGAA pLKO_005 149 CDS 100% 1.650 1.155 N OAZ1 n/a
9 TRCN0000078496 GCCGCACCATGCCGCTCCTAA pLKO.1 205 CDS 100% 0.000 0.000 N OAZ1 n/a
10 TRCN0000286513 GCCGCACCATGCCGCTCCTAA pLKO_005 205 CDS 100% 0.000 0.000 N OAZ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004152.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11007 pDONR223 100% 29.7% 100% None 205_685del n/a
2 ccsbBroad304_11007 pLX_304 0% 29.7% 100% V5 205_685del n/a
3 TRCN0000479612 CTCAAACGATGGACCAATGACCCC pLX_317 100% 29.7% 100% V5 205_685del n/a
Download CSV